The intellectual disability-associated CAMK2G p.Arg292Pro mutation acts as a pathogenic gain-of-function

Abstract

The abundantly expressed calcium/calmodulin-dependent protein kinase II (CAMK2) alpha (CAMK2A) and beta (CAMK2B) isoforms are essential for learning and memory formation. Recently, a de novo candidate mutation (p.Arg292Pro) in the gamma isoform of CAMK2 (CAMK2G) was identified in a patient with severe intellectual disability (ID), but the mechanism(s) by which this mutation causes ID is unknown. Here we identified a second, unrelated individual, with a de novo CAMK2G p.Arg292Pro mutation, and used in vivo and in vitro assays to assess the impact of this mutation on CAMK2G and neuronal function. We found that knock-down of CAMK2G results in inappropriate precocious neuronal maturation. We further found that the CAMK2G p.Arg292Pro mutation acts as a highly pathogenic gain-of-function mutation, leading to increased phosphotransferase activity and impaired neuronal maturation as well as impaired targeting of the nuclear CAMK2G isoform. Silencing the catalytic site of the CAMK2G p.Arg292Pro protein reversed the pathogenic effect of the p.Arg292Pro mutation on neuronal maturation, without rescuing its nuclear targeting. Taken together, our results reveal an indispensable function of CAMK2G in neurodevelopment and indicate that the CAMK2G p.Arg292Pro protein acts as a pathogenic gain-of-function mutation, through constitutive activity towards cytosolic targets, rather than impaired targeting to the nucleus.

TAOK1 is associated with neurodevelopmental disorder and essential for neuronal maturation and cortical development

“…The complementary DNA (cDNA) sequence from human TAOK1 WT (NM_020791.2) was obtained from a human brain cDNA library by polymerase chain reaction (PCR) (Phusion high fidelity; Thermo Fisher Scientific) using the following primers: Fw 5’‐GGCGCGCCTCCATGGGCCCATCAACTAACAGAGCAGG‐3’ and Rev 5’‐TTAATTAAGCGGCCGCTTATGTATAAGACATGTGTGACCC‐3’ and cloned into our dual promoter expression vector containing the CAGG promoter to drive transcription of the gene of interest and a separate PGK promoter for transcription of the tdTomato gene (Küry et al, 2017; Proietti Onori et al, 2018; Reijnders et al, 2017). The single‐nucleotide point mutation was introduced by PCR (Phusion high fidelity, Thermo Fisher Scientific) using the following primers: TAOK1 –c.449G>T (p.Arg150Ile), Fw 5’‐CATTCTCATACTATGATTCATATAGATATCAAAGCAGGAAATATC‐3’ and Rev 5’‐GATATTTCCTGCTTTGATATCTATATGAATCATAGTATGAGAATG‐3’.…”

“…The procedure was performed as described previously (Proietti Onori et al, 2018). In short, pregnant FvB/NHsD mice at E14.5 of gestation were anesthetized, and the uterus was exposed.…”

“…Neuronal migration analysis was performed using confocal images (×10 objective, 0.5 zoom, 1024 × 1024 pixels) obtained from two to three nonconsecutive sections from at least three successfully targeted animals per plasmid, as previously described (Küry et al, 2017; Proietti Onori et al, 2018; Reijnders et al, 2017). Briefly, images were rotated to correctly position the cortical layers, and the number of cells in different layers were counted using ImageJ (Analyze Particles option).…”

GHB confers neuroprotection by stabilizing the CaMKIIα hub domain

“…Plasmids were all rat: pCMV6-CaMKIIα-Myc-DDK, (#RR201121), pCMV6-CaMKIIγ-Myc-DDK (#RR207416), pCMV6-CaMKIIδ-Myc-DDK (#RR209882), all from Addgene, pCAGG-CaMKIIβ-pPGK-tdTOMATO 37 . Mutations R433Q, R453Q, R469Q, H395A and the triple mutant R433/453/469Q in CaMKIIα in pCMV6-Myc-DDK were generated and sequence-verified by GenScript.…”

CaMKII controls neuromodulation via neuropeptide gene expression and axonal targeting of neuropeptide vesicles

“…pCMV(pr)Camk2a-pCamkII(pr)eCFP and pCMV(pr)Camk2b-pCamkII(pr)eCFP were created by substituting tdTomato to eCFP from the plasmid in [83]. pSyn(pr)Synapsin-mCherry [39], pSyn(pr)BDNF-pHluorin, and pSyn(pr)BDNF-mCherry were engineered by replacing NPY with cDNA of BDNF from the plasmid encoding pSyn(pr)NPY-pHluorin [38] and pSyn (pr)NPY-mCherry [38].…”