The in vivo conformation of the plastid DNA of Toxoplasma gondii: implications for replication11Edited by N.-H. Chua

Williamson, D. H.; Denny, Paul W.; Moore, P. W.; Sato, Shigeharu; McCready, Shirley; Wilson, Robert

doi:10.1006/jmbi.2000.4385

Cited by 35 publications

(20 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Hybridization Probes-Oligonucleotides recognizing the cytosolic 5.8 S rRNA (GAGCCAAGACATCCATTG) (19), the plastid tRNA Met (AAC-CTGCTCTACCCCGCT) (20), and the mitochondrial large subunit (LSU) rRNA fragment (GACAAGGATTTTCCTACCTT) of T. gondii (21) were designed using published sequence information. The probe to detect mitochondrial-encoded cytochrome b mRNA (6) was prepared by PCR amplification using CGAGAACACTCAGTCTATC and CAGAT-ACGTAGAAACCTCC as primers.…”

Section: Subcellular Fractionation Of T Gondii-washed T Gondii Cellmentioning

confidence: 99%

Mitochondrial tRNA Import in Toxoplasma gondii

Esseiva

Naguleswaran

Hemphill

et al. 2004

Journal of Biological Chemistry

View full text Add to dashboard Cite

Apicomplexan parasites have the smallest known mitochondrial genome. It consists of a repeated element of ϳ6 -7 kb in length and encodes three mitochondrial proteins, a number of rRNA fragments, but no tRNAs. It has therefore been postulated that in apicomplexans all tRNAs required for mitochondrial translation are imported from the cytosol. To provide direct evidence for this process we have established a cell fractionation procedure allowing the isolation of defined organellar RNA fractions from the apicomplexan Toxoplasma gondii. Analysis of T. gondii total and organellar RNA by Northern hybridization showed that except for the cytosol-specific initiator tRNA Met all nucleus-encoded tRNAs tested were present in the cytosol and in the mitochondrion but not in the plastid. Thus, these results provide the first experimental evidence for mitochondrial tRNA import in apicomplexans. The only other taxon that imports the whole set of mitochondrial tRNAs are the trypanosomatids. Interestingly, the initiator tRNA Met is the only cytosol-specific tRNA in trypanosomatids, indicating that the import specificity is identical in both groups. In agreement with this, the T. gondii initiator tRNA Met remained in the cytosol when expressed in Trypanosoma brucei. However, in contrast to trypanosomatids, no thio-modifications were detected in the tRNA Gln of T. gondii indicating that, unlike what is suggested in Leishmania, they are not involved in regulating import.

show abstract

Section: Subcellular Fractionation Of T Gondii-washed T Gondii Cellmentioning

confidence: 99%

Mitochondrial tRNA Import in Toxoplasma gondii

Esseiva

Naguleswaran

Hemphill

et al. 2004

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Many different architectures, from single-stranded DNA, to linear DNA molecules, to small and large circles, to complex rosette structures have been observed in derived genomes (Williamson et al, 2001;Backert et al, 1997b). The formation of these strange architectures may be connected to their replicative modes.…”

Section: Recombination and Replication Originsmentioning

confidence: 97%

Double hairpin elements and tandem repeats in the non-coding region of Adenoides eludens chloroplast gene minicircles

Nelson

Green

2005

Gene

View full text Add to dashboard Cite

“…Interestingly, Williamson et al (2001) have recently reported that half of the copies of the Toxoplasma gondii apicoplast genome actually occur as precise tandem linear arrays. From this they invoke a rolling circle hypothesis for DNA replication in this parasite with the origin of replication at the centre of the inverted repeat of rRNA genes.…”

Section: Dna Replicationmentioning

confidence: 99%

“…From this they invoke a rolling circle hypothesis for DNA replication in this parasite with the origin of replication at the centre of the inverted repeat of rRNA genes. It is noted that other apicomplexa also display an element of linearity with their apicoplast genomes (Eimeria tenella (Dunn et al, 1998) and Neospora caninum (Gleeson, 2000)) although in Plasmodium falciparum at least 90% of its apicoplast DNA is said to be in the circular conformation (Williamson et al, 2001). It remains to be seen what mode of DNA replication occurs in these.…”

Section: Dna Replicationmentioning

confidence: 99%

The Apicoplast: A Review of the Derived Plastid of Apicomplexan Parasites

Waller

McFadden²

2005

Current Issues in Molecular Biology

View full text Add to dashboard Cite

The apicoplast is a plastid organelle, homologous to chloroplasts of plants, that is found in apicomplexan parasites such as the causative agents of Malaria Plasmodium spp. It occurs throughout the Apicomplexa and is an ancient feature of this group acquired by the process of endosymbiosis. Like plant chloroplasts, apicoplasts are semi-autonomous with their own genome and expression machinery. In addition, apicoplasts import numerous proteins encoded by nuclear genes. These nuclear genes largely derive from the endosymbiont through a process of intracellular gene relocation. The exact role of a plastid in parasites is uncertain but early clues indicate synthesis of lipids, heme and isoprenoids as possibilities. The various metabolic processes of the apicoplast are potentially excellent targets for drug therapy.

show abstract

The in vivo conformation of the plastid DNA of Toxoplasma gondii: implications for replication11Edited by N.-H. Chua

Cited by 35 publications

References 36 publications

Mitochondrial tRNA Import in Toxoplasma gondii

Mitochondrial tRNA Import in Toxoplasma gondii

Double hairpin elements and tandem repeats in the non-coding region of Adenoides eludens chloroplast gene minicircles

The Apicoplast: A Review of the Derived Plastid of Apicomplexan Parasites

Contact Info

Product

Resources

About