TheDrosophilaERG channelseizureplays a role in the neuronal homeostatic stress response

Abstract

Neuronal physiology is particularly sensitive to acute stressors that affect excitability, many of which can trigger seizures and epilepsies. Although intrinsic neuronal homeostasis plays an important role in maintaining overall nervous system robustness and its resistance to stressors, the specific genetic and molecular mechanisms that underlie these processes are not well understood. Here we used a reverse genetic approach in Drosophila to test the hypothesis that specific voltage-gated ion channels contribute to neuronal homeostasis, robustness, and stress resistance. We found that the activity of the voltage-gated potassium channel seizure (sei), an ortholog of the mammalian ERG channel family, is essential for protecting flies from acute heat-induced seizures. Although sei is broadly expressed in the nervous system, our data indicate that its impact on the organismal robustness to acute environmental stress is primarily mediated via its action in excitatory neurons, the octopaminergic system, as well as glia. Furthermore, our studies suggest that human mutations in the human ERG channel (hERG), which have been primarily implicated in the cardiac Long QT Syndrome (LQTS), may also contribute to the high incidence of seizures in LQTS patients via a cardiovascular-independent neurogenic pathway.

Drosophila ßHeavy-Spectrin is required in polarized ensheathing glia that form a diffusion-barrier around the neuropil

“…Likewise, the Excitatory amino acid transporter 2 (Eaat2) functions in ensheathing glia to modulate sleep in the adult 38 . In addition, cell type specific knockdown experiments demonstrate that the voltage-gated potassium channel encoded by the gene seizure (sei) is required in ensheathing glia to protect flies from acute heatinduced seizures 39 .…”

A pleiotropic chemoreceptor facilitates the functional coupling of pheromone production and perception

“…The GFP-tagged allele of Gr8a was generated via CRISPR/Cas9-dependent editing using a modified "scarless" strategy by using the sgRNA CGAGCAAGGCGGGAACGATT and a 3XP3>dsRed in the donor plasmid as a reporter for edited animals as previously described (Hill et al, 2017;Hill et al, 2019). Control lines with matching genetic backgrounds were established by selecting DsRed-negative injected animals.…”

“…Control lines with matching genetic backgrounds were established by selecting DsRed-negative injected animals. The final tagged Gr8a allele was generated by removing the DsRed cassette via the introduction of the piggyBac transposase (Hill et al, 2019).…”

“…cDNAs were synthesized using SuperScript II reverse transcriptase (Thermo Fisher Scientific) with 500 ng total RNA in a 20 uL reaction. Real-time quantitative RT-PCR was carried out as previously described with Rp49 as the loading control gene (Hill et al, 2017;Hill et al, 2019;Lu et al, 2012;Lu et al, 2014;Zheng et al, 2014). Primer sequences are described in Supplemental Tables 1-3.…”