The Human T-Cell Leukemia Virus Type 1 Tax Oncoprotein Requires the Ubiquitin-Conjugating Enzyme Ubc13 for NF-κB Activation

Abstract

Ubiquitination of the human T-cell leukemia virus 1 Tax oncoprotein provides an important regulatory mechanism that promotes the Tax-mediated activation of NF-B. However, the type of polyubiquitin chain linkages and the host factors that are required for Tax ubiquitination have not been identified. Here, we demonstrate that Tax polyubiquitin chains are composed predominantly of lysine 63-linked chains. Furthermore, the ubiquitination of Tax is critically dependent on the E2 ubiquitin-conjugating enzyme Ubc13. Tax interacts with Ubc13, and small interfering RNA-mediated knockdown of Ubc13 expression abrogates Tax ubiquitination and the activation of NF-B. Mouse fibroblasts lacking Ubc13 exhibit impaired Tax activation of NF-B despite normal tumor necrosis factor-and interleukin-1-mediated NF-B activation. Finally, the interaction of Tax with NEMO is disrupted in the absence of Tax ubiquitination and Ubc13 expression, suggesting that Tax ubiquitination is critical for NEMO binding. Collectively, our results reveal that Ubc13 is essential for Tax ubiquitination, its interaction with NEMO, and Tax-mediated NF-B activation.

Suppression of HTLV-1 replication by Tax-mediated rerouting of the p13 viral protein to nuclear speckles

“…Briefly, Tax recruits K48-specific E2 and E3 enzymes that result in serine/threonine ubiquitination and possibly other posttranslational modifications of p13, or, as suggested by others, in Tax functioning as an E3 ligase. 36 The p13 protein is stabilized through K48-dependent di-ubiquitination of serine and/or threonine residues, resulting in rerouting of p13 to the nucleus. Ghorbel et al identified a nuclear localization signal at the C-terminus of p30, 59 a region that corresponds to the C-terminus of p13.…”

“…44 Recently, it was demonstrated that Tax is mainly K63-linked polyubiquitinated, and that this ubiquitination is dependent on the E2 ubiquitin-conjugation enzyme Ubc13, which is critical for NEMO interaction and NF-B activation. 36 The Tax mutant M22 is deficient in NF-B activation, is not ubiquitinated, and does not interact with Ubc13. 36,53 In the cytoplasm, Tax also concentrates in perinuclear speckles that localize near the centrosome, the microtubule-organizing center, and the cis-Golgi.…”

“…36 The Tax mutant M22 is deficient in NF-B activation, is not ubiquitinated, and does not interact with Ubc13. 36,53 In the cytoplasm, Tax also concentrates in perinuclear speckles that localize near the centrosome, the microtubule-organizing center, and the cis-Golgi. 54,56,57 Recently, K63-polyubiquitinated Tax was shown to recruit inhibitor B kinase complex to this perinuclear compartment, supporting a model in which Tax activates inhibitor B kinase in a centrosome-dependent manner.…”

“…Tax has been shown to be both mono-and polyubiquitinated. 36,44,[52][53][54][55] Ubiquitination of Tax is important for both activation of the canonical and noncanonical NF-B pathway and localization to the cytoplasm. 44 Conversely, Tax is also sumoylated, which directs its nuclear localization and is important for both NF-B activation and HTLV-1 LTR activity.…”

“…The HA-fused ubiquitin constructs (WT, K63 only, and K48 only) were kindly provided by Dr Edward Harhaj (University of Miami, Miami, FL) with permission from Dr Shao-Cong Sun (M. D. Anderson Cancer Center, University of Texas, Houston, TX). 36 The HA tag in these 3 constructs was changed to an AU1 tag (DTYRYI) by PCR using the following primers flanked with KpnI and XbaI: AU1-Ub-F: 5ЈAGCTGGTACCACCATGGACACCTATCGC-TATATATCTCCCGAATTCGCGGCCGCGTCG 3Ј and AU1-Ub-R: 5Ј AGCTTCTAGAGGAAGAAGTCCAAAGCTT 3Ј, creating AU1-Ub-WT, AU1-Ub-K63, and AU1-Ub-K48. The reporter constructs HTLV-1 LTR luciferase (LTR-Luc) and RxRE-CAT 37 were kindly provided by Dr Madeleine Duc Dodon (Virologie Humaine, Inserm, Lyon, France), the molecular clone pcRex was kindly provided by Dr David Derse (now deceased), and pAB and pcTax have been described previously.…”