The human immunoglobulin C_μ–C_δlocus: complete nucleotide sequence and structural analysis

Abstract

The entire nucleotide sequence (approximately 20 kbp) spanning the human immunoglobulin IgM (mu) and IgD (delta) heavy chain constant region genes has been determined from DNA of mu-delta producing chronic lymphocytic leukemic B cells. As in the murine IgM + IgD double-producing B cells, no rearrangement has occurred in the C mu-C delta region in the leukemic cells. The C mu locus is highly conserved between mouse and human with the exception of the nucleotide sequence between the C mu 4 and mu M1 exons, which has diverged dramatically. The intergenic sequence between human C mu and C delta is three times larger than the analogous region in the mouse and contains notable features absent from the mouse, including a 443 bp segment that is 96% identical to a 442 bp sequence that occurs just 3' to the heavy chain enhancer, a 366 bp sequence that is directly repeated with 76% homology, and 12 tandem copies of a 35 bp sequence. The human C delta gene contains two additional exons relative to mouse C delta, but shares with the mouse the unique distal location of both secreted and membrane coding segments. Several polymorphisms in the human population have been identified in the intergenic region and in C delta but not in C mu.

The Complete Map of the Ig Heavy Chain Constant Gene Region Reveals Evidence for Seven IgG Isotypes and for IgD in the Horse

“…Recently, an IGHD gene was identified in cattle, sheep, and pigs (21). As in other mammals, the equine IGHD gene is located downstream of the IGHM gene, and the genomic gene structure with eight individual exons is very similar to that of the human IGHD gene (43). In another similarity to the IGHD genes of humans and rodents, no switch region was found upstream of the equine IGHD gene, and the distance between the equine IGHM and IGHD genes (5 kb) is even shorter than that in the human IGHC region (6 kb).…”

Immunoglobulin D switching can occur through homologous recombination in human B cells.

“…The PCR technique (47) was used to amplify the C, deletion (IgD switch) endpoints and the germ line (unrearranged) 442-and 443-bp regions from myeloma DNA, Bcell-enriched and -unenriched peripheral blood lymphocyte (PBL) DNA, and splenocyte and fibroblast DNA. Oligonucleotides prepared on an ABI/380A DNA synthesizer and purified by high-pressure liquid chromatography were the following: primer 1, (5') AATGGATCCGTTCACAATCT TTTTAGGTTAACTCG (3') (bases 515 to 540, Mills et al [30]); primer 2, (5') AAGGGATCCGGGAGTGACCCAGA CAATGGTC (3') (bases 1143 to 1164, Mills et al [30]); primer 3, (5') ATCGGATCCCTACCTCACACATTACCCT ATCCG (3') (bases 8503 to 8526, Word et al [61]); primer 4, (5') CAAGGATCCCCAGCAAACCAACAAAAGCCAGG (3') (bases 9206 to 9232, Word et al [61] and 16.1 indicated that the 3' C,, gene deletion endpoint was near the copy of the 442/443-bp repeat that exists upstream of the C8, gene. By analyzing the DNA sequence across the deletion endpoints, it was determined that the C, gene was deleted in these two clones via the 442/443-bp repeat and that exactly one copy of this repeat was retained in each of these clones.…”

“…Indeed, after obtaining the sequence of the entire 19,800-base-pair (bp) region that * Corresponding author. spans the C,J and C. genes in the human genome (31,60,61), two regions within the C ,-C. intron emerged as candidates for switch recombination. First, we noted a 2-kb region containing an unusually high concentration of the pentamer TGGGG (bases 5950 to 7950 [61]) that is characteristic of all murine switch regions.…”

“…spans the C,J and C. genes in the human genome (31,60,61), two regions within the C ,-C. intron emerged as candidates for switch recombination. First, we noted a 2-kb region containing an unusually high concentration of the pentamer TGGGG (bases 5950 to 7950 [61]) that is characteristic of all murine switch regions. Second, we (61) and others (1) noted that a 443-bp stretch about 1.7 kbp upstream of C., (bases 8572 to 9014 [61]) is almost perfectly duplicated (96% match) within the JH-C,, intron some 1.5 kbp 5' of S,, (30).…”

Differential Segmental Flexibility and Reach Dictate the Antigen Binding Mode of Chimeric IgD and IgM: Implications for the Function of the B Cell Receptor

“…The plasmid vector pAS24 (a gift from Dr. P. W. Tucker, Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, TX) contains a 9.9-kb genomic sequence encoding an incomplete human ␦ locus in pBR322 (31). Using this plasmid as the initial template, a wildtype (wt) and a h1 exon deletion mutant (⌬h1) ␦-chain were generated.…”