The hTAF_II68‐TEC fusion protein functions as a strong transcriptional activator

Abstract

Human extraskeletal myxoid chondrosarcoma (EMC) is caused by a chromosomal translocation that involves TEC (translocated in extraskeletal myxoid chondrosarcoma), and either EWS (Ewing's sarcoma) or hTAF II 68 (human TATA-binding proteinassociated factor II 68), which generates EWS-TEC or hTAF II 68-TEC fusion proteins, respectively. Although there has been a great deal of progress in characterizing EWS-TEC, there is relatively little known about the biological function of hTAF II 68-TEC. We have examined the functional consequences of the fusion of the amino terminal domain (NTD) of hTAF II 68 to TEC in EMC. The chimeric gene encodes a nuclear protein that binds DNA with the same sequence specificity as parental TEC. Nuclear localization of hTAF II 68-TEC was dependent on the DNA binding domain, and we identified a cluster of basic amino acids in the DNA binding domain, KRRR, that specifically mediate the nuclear localization of hTAF II 68-TEC. The transactivation activity of hTAF II 68-TEC was higher than TEC towards a known target promoter that contained several TEC binding sites. Finally, deletion analysis of hTAF II 68-TEC indicated that the hTAF II 68 NTD, and the AF1 and AF2 domains of hTAF II 68-TEC are necessary for full transactivation potential. These results suggest that the oncogenic effect of the t(9;17) translocation may be due to the hTAF II 68-TEC chimeric protein and that fusion of the hTAF II 68 NTD to the TEC protein produces a gain of function chimeric product. ' 2008 Wiley-Liss, Inc.Key words: hTAF II 68-TEC; chromosomal translocation; fusion protein; transactivation; nuclear localization signal; human extraskeletal chondrosarcoma The loss of cellular growth regulation that gives rise to tumorigenesis originates with genetic changes in the cell. The t(9;17)(q22;q11.2) chromosomal translocation is associated with human extraskeletal myxoid chondrosarcoma (EMC), and results in the generation of a chimeric molecule consisting of the NTD of hTAF II 68 (also named TAF2N and RBP56) fused to full-length translocated in extraskeletal myxoid chondrosarcoma (TEC). 1,2 Human EMC is a soft tissue tumor of uncertain histogenetic origin that arises primarily in the musculature, most commonly in the thigh and knee. 3,4 hTAF II 68 encodes a putative RNA/single stranded DNA-binding protein that associates with TFIID and RNA polymerase II. 5 The gene for hTAF II 68 was originally identified because of its homology to the proto-oncogenes EWS and TLS (Translocated in lymphosarcoma), a member of the EWS gene family. 5,6 EWS and TLS are involved in several tumor-related chromosomal translocations that result in gene fusions with a number of putative transcription factors, such as Fli-1, ERG, ETV1, E1A-F, FEV, WT1, ATF1, CHOP and TEC. 7,8 In each case, the translocation produces a chimeric molecule containing the NTD of EWS or TLS fused to the DNA binding domain of its partner. Recently, a new translocation involving the EWS gene was identified in some bone and softtissue tumors. 9 In these tumors, a t(6;22)(p21;...

Extraskeletal myxoid chondrosarcoma with non–EWSR1-NR4A3 variant fusions correlate with rhabdoid phenotype and high-grade morphology

“…Both EWSR1-NR4A3 and TAF15-NR4A3 fusion proteins have been shown to be strong transcriptional activators. [23, 24]…”

Cytogenetics and Molecular Genetics of Myxoid Soft-Tissue Sarcomas

“…The EWSR1-NR4A3 fusion protein is thought to function as a potent transcriptional activator for NR4A3 -target genes [85, 86]. It has also been shown that the TAF15-NR4A3 fusion protein functions a strong transcriptional activator [87]. It is unclear whether the fusion transcript type is associated with particular morphological features or clinical outcome.…”

The TFG-TEC oncoprotein induces transcriptional activation of the humanβ-enolasegene via chromatin modification of the promoter region

“…The pCMV‐Tag2A/TFG‐TEC, pCMV‐Tag2A/TFG (NTD), pCMV‐Tag2A/TEC, and pCMV‐Tag2A/TFG‐TEC (AAAA) expression plasmids have been described previously . To generate the pEnoβ‐Luc reporter plasmid, the human β ‐ enolase promoter (nucleotides −787 to +79 relative to the start of transcription; Figure ) was amplified from human genomic DNA by PCR using the following primers: hEnoβ‐787(s), 5′‐GATCGGTACCACAAAAGGCCACCCGTCC‐3′ (KpnI site underlined) and hEnoβ+79(as), 5′‐GATCCTCGAGCTGGAAGATTCACCCGAC‐3′ (XhoI site underlined).…”