The glucocorticoid receptor mediates the thymic epithelial cell-induced apoptosis of CD4+8+ thymic lymphoma cells

Zilberman, Yoram; Zafrir, Elazar; Ovadia, Haim; Yefenof, Eitan; Guy, Rina; Sionov, Ronit Vogt

doi:10.1016/j.cellimm.2004.01.005

Cited by 26 publications

(30 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Zilberman et al (43) identified this soluble factor as a steroid produced by TEC because double-positive CD4 ϩ CD8 ϩ thymocyte apoptosis was inhibited when cells were exposed to GR inhibitor RU-486. Moreover, they demonstrated that low levels of GC produced by TEC seemed sufficient to alter both GR expression and sensitivity to GC in thymocytes (44). However, because thymic content of CORT is very low, on the order of 1:100,000 of the content of the adrenal, some data suggest that de novo GC production within the thymus is insufficient to exert GC signaling in thymocytes.…”

Section: Discussionmentioning

confidence: 95%

“…When 267S3 cells were exposed concomitantly to DHC (1 M) and a nondeleterious concentration of CORT (0.01 M), apoptosis levels were higher than with cells treated with DHC (1 M) alone, suggesting that DHC conversion to CORT is an additive event leading to increased intracellular CORT concentration and sensitivity to GC. 11␤-HSD1 as been shown to be regulated by proinflammatory cytokines in various cell types (5,12,44). On the other hand, thymocytes are responsive to major proinflammatory cytokines, namely IL-1␤, IL-6, and TNF-␣ (34).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Regulation of glucocorticoid sensitivity in thymocytes from burn-injured mice

D’Elia¹,

Patenaude²,

Bernier³

2009

American Journal of Physiology-Endocrinology and Metabolism

View full text Add to dashboard Cite

Glucocorticoids (GC) are important steroid hormones that regulate metabolism, development, and the immune system. GC are produced continuously, and maximal levels are reached following stress-related stimuli. Previous studies have demonstrated that increased GC production following thermal injury was responsible for thymic involution. Although GC are mainly synthesized by the adrenal glands, there is increasing evidence that GC may also be produced in nonadrenal tissues. The thymus was reported to express steroidogenic enzymes and to release GC. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is predominantly a reductase in cells and is essential for the local reactivation of GC. Here, we report that increased GC-induced apoptosis in thymocytes from burn-injured mice is related to increased glucocorticoid receptor (GR) expression and 11β-HSD1 expression in thymocytes at day 1 postburn injury. In vitro, thymocytes were able to convert 11-dehydrocorticosterone (DHC) to corticosterone (CORT), which induced their apoptosis, and this was pharmacologically inhibited by 18β-glycyrrhetinic acid, a specific 11β-HSD inhibitor. Moreover, 11β-HSD1 expression was confirmed in the 267S3 thymoma-derived cell line, and its activity was responsible for greater sensitivity of these cells to CORT-induced apoptosis. Finally, proinflammatory cytokines [tumor necrosis factor-α, interleukin (IL)-1β, and IL-6] increased thymocyte sensitivity to DHC-induced apoptosis through a mechanism involving 11β-HSD1. Overall, we have shown that burn injury induced 11β-HSD1 expression in thymocytes, which led to a greater sensitivity of these cells to CORT-induced apoptosis. Increased expression of 11β-HSD1 and GR may play a role in intrathymic T cell development and can be major determinants of GC sensitivity after a trauma.

show abstract

Section: Discussionmentioning

confidence: 95%

Section: Discussionmentioning

confidence: 99%

Regulation of glucocorticoid sensitivity in thymocytes from burn-injured mice

D’Elia¹,

Patenaude²,

Bernier³

2009

American Journal of Physiology-Endocrinology and Metabolism

View full text Add to dashboard Cite

show abstract

“…Additional indication that GR transcriptional activity is necessary for the initiation of the GCs mediated apoptosis has been provided by the observation that various mutations affecting GR transcriptional activity have been detected in patients exhibiting resistance to glucocorticoids treatment [2,46]. Furthermore, prolonged glucocorticoid treatment significantly reduces GR expression [47], whereas GR expression is not affected [48].…”

Section: Gr Transcriptional Activity Is Necessary For Its Pro-apoptotmentioning

confidence: 98%

Molecular Mechanisms Conferring Resistance/Sensitivity to Glucocorticoid-Induced Apoptosis

Berrou¹,

Krstic‐Demonacos²,

Demonacos³

2012

Glucocorticoids - New Recognition of Our Familiar Friend

View full text Add to dashboard Cite

“…1G and H). The GR-deficient PD1.6Dex -subline, which possesses the apoptotic machinery required for GC-induced apoptosis except for lacking GR, 29 could not be sensitized to Dex by STS (Fig. 1G).…”

Section: Sts Sensitizes T Lymphoma But Not Myelogenic Leukemia Cellmentioning

confidence: 99%

“…The GR-deficient PD1.6Dex -cells were derived from PD1.6 cells by repeated exposure to increasing concentrations of Dex until GC-resistance was attained. 29 Plasmid preparation. Dominant-negative Nur77 (aa252-601) was prepared by PCR on the mouse pcDNA3HANur77 plasmid (kindly provided by Dr. H.-S. Choi, Chonnam National University, Seoul, Korea), using the 5' primer CCGCTCGAGGCCGCCACC ATGCCCGTGACCTCCACCAAGTC containing a XhoI restriction site and a Kozac sequence upstream to ATG, and the 3'-primer CCGGAATTCTCAGAAAGACAATGTGTCC containing a stop codon and an EcoRI restriction site.…”

Section: Methodsmentioning

confidence: 99%