The genetic architecture of susceptibility to parasites

Wilfert, Lena; Schmid‐Hempel, Paul

doi:10.1186/1471-2148-8-187

Cited by 100 publications

(108 citation statements)

References 19 publications

(18 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…When we scanned for additional QTL that modify the effect of the first set of QTL we identified, we were able to identify an additional locus that reversed the effect of a resistance gene. Wilfert and Schmid‐Hempel (Wilfert & Schmid‐Hempel 2008) reviewed published studies that have identified QTL for host resistance in animals and plants, and found that epistatic interactions were presented in the majority of cases and were responsible for a substantial amount of the explained variance. Our results suggest that in our system epistatic interactions do occur, but they are unlikely to have such pervasive effects.…”

Section: Discussionmentioning

confidence: 99%

“…We used PCR to genotype the founder lines and selected RILs for polymorphisms in the genes ref(2)p and CHKov1 that have been previously associated with virus resistance. Two flanking universal primers (ref2p‐P1‐F 5′‐CTCACCCAGCTGCACTTGTA‐3′, ref2p‐PS1‐R 5′‐TGTTGCAATCTTTGCGACTC‐3′) and a specific primer for each allele (susceptible allele: ref‐a1‐Forward 5′‐GGATGCCCTCCCAGAATTA‐3′; recessive allele: ref‐a1‐Reverse 5′‐ CGACGCAATRYGGTGTATCC‐3′) were used to genotype ref(2)p (Wilfert & Schmid‐Hempel 2008). A forward primer CHK_F (59 CTCTTGGCTCCAAACGTGAC 39) and reverse primer CHK_R (59 AAGGCAAACGACGCTCTT 39) were used to detect the absence of the Doc1420 element in CHKov1 .…”

Section: Methodsmentioning

confidence: 99%

“…Major‐effect polymorphisms that decrease susceptibility to infection have been identified in many organisms by both GWAS and classical QTL and linkage mapping (Bangham et al . 2007, 2008; Wilfert & Schmid‐Hempel 2008; Magwire et al . 2011, 2012; Hill 2012; Cao et al .…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

The genetic architecture of resistance to virus infection in Drosophila

et al. 2016

View full text Add to dashboard Cite

Variation in susceptibility to infection has a substantial genetic component in natural populations, and it has been argued that selection by pathogens may result in it having a simpler genetic architecture than many other quantitative traits. This is important as models of host–pathogen co‐evolution typically assume resistance is controlled by a small number of genes. Using the Drosophila melanogaster multiparent advanced intercross, we investigated the genetic architecture of resistance to two naturally occurring viruses, the sigma virus and DCV (Drosophila C virus). We found extensive genetic variation in resistance to both viruses. For DCV resistance, this variation is largely caused by two major‐effect loci. Sigma virus resistance involves more genes – we mapped five loci, and together these explained less than half the genetic variance. Nonetheless, several of these had a large effect on resistance. Models of co‐evolution typically assume strong epistatic interactions between polymorphisms controlling resistance, but we were only able to detect one locus that altered the effect of the main effect loci we had mapped. Most of the loci we mapped were probably at an intermediate frequency in natural populations. Overall, our results are consistent with major‐effect genes commonly affecting susceptibility to infectious diseases, with DCV resistance being a near‐Mendelian trait.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The genetic architecture of resistance to virus infection in Drosophila

et al. 2016

View full text Add to dashboard Cite

show abstract

“…The extent of trait variance explained by a QTL is essentially a question of genetic architecture, i.e. of the number, effect size and allelic interactions of all the loci affecting the trait [203].…”

Section: The Importance Of Understanding Genetic Architecturementioning

confidence: 99%

“…Second, mapping studies do not necessarily provide a reliable guide to the contribution made by a QTL to the genetic variance of a quantitative trait in natural populations, because the extent of this contribution depends critically upon allele frequencies, which will differ among populations [207]. Finally, there is increasing evidence that epistatic effects (interactions among loci) explain a substantial portion the genetic variance in many quantitative traits [203,206,208]; this means that the effect of any particular QTL will vary depending on the genetic background.…”

Section: The Importance Of Understanding Genetic Architecturementioning

confidence: 99%

The molecular epidemiology of parasite infections: Tools and applications

Lymbery

Thompson

2012

Molecular and Biochemical Parasitology

View full text Add to dashboard Cite

Molecular epidemiology, broadly defined, is the application of molecular genetic techniques to the dynamics of disease in a population. In this review, we briefly describe molecular and analytical tools available for molecular epidemiological studies and then provide an overview of how they can be applied to better understand parasitic disease. A range of new molecular tools have been developed in recent years, allowing for the direct examination of parasites from clinical or environmental samples, and providing access to relatively cheap, rapid, high throughput molecular assays. At the same time, new analytical approaches, in particular those derived from coalescent theory, have been developed to provide more robust estimates of evolutionary processes and demographic parameters from multilocus, genotypic data. To date, the primary application of molecular epidemiology has been to provide specific and sensitive identification of parasites and to resolve taxonomic issues, particularly at the species level and below. Population genetic studies have also been used to determine the extent of genetic diversity among populations of parasites and the degree to which this diversity is associated with different host cycles or epidemiologically important phenotypes. Many of these studies have also shed new light on transmission cycles of parasites, particularly the extent to which zoonotic transmission occurs, and on the prevalence and importance of mixed infections with different parasite species or intraspecific variants (polyparasitism). A major challenge, and one which is now being addressed by an increasing number of studies, is to find and utilise genetic markers for complex traits of epidemiological significance, such as drug resistance, zoonotic potential and virulence.

show abstract

Quantitative disease resistance in wild Silene vulgaris to its endemic pathogen Microbotryum silenes‐inflatae

Hood,

Nelson,

Cho

et al. 2023

Ecology and Evolution

View full text Add to dashboard Cite

The evolution of disease resistances is an expected feature of plant–pathogen systems, but whether the genetics of this trait most often produces qualitative or quantitative phenotypic variation is a significant gap in our understanding of natural populations. These two forms of resistance variation are often associated with differences in number of underlying loci, the specificities of host–pathogen coevolution, as well as contrasting mechanisms of preventing or slowing the infection process. Anther‐smut disease is a commonly studied model for disease of wild species, where infection has severe fitness impacts, and prior studies have suggested resistance variation in several host species. However, because the outcome of exposing the individual host to this pathogen is binary (healthy or diseased), resistance has been previously measured at the family level, as the proportion of siblings that become diseased. This leaves uncertain whether among‐family variation reflects contrasting ratios of segregating discrete phenotypes or continuous trait variation among individuals. In the host Silene vulgaris, plants were replicated by vegetative propagation in order to quantify the infection rates of the individual genotype with the endemic anther‐smut pathogen, Microbotryum silenes‐inflatae. The variance among field‐collected families for disease resistance was significant, while there was unimodal continuous variation in resistance among genotypes. Using crosses between genotypes within ranked resistance quartiles, the offspring infection rate was predicted by the parental resistance values. While the potential remains in this system for resistance genes having major effects, as there were suggestions of such qualitative resistance in a prior study, here the quantitative disease resistance to the endemic anther‐smut pathogen is indicated for S. vulgaris. The variation in natural populations and strong heritability of the trait, combined with severe fitness consequences of anther‐smut disease, suggests that resistance in these host populations is highly capable of responding to disease‐induced selection.

show abstract

The genetic architecture of susceptibility to parasites

Cited by 100 publications

References 19 publications

The genetic architecture of resistance to virus infection in Drosophila

The genetic architecture of resistance to virus infection in Drosophila

The molecular epidemiology of parasite infections: Tools and applications

Quantitative disease resistance in wild Silene vulgaris to its endemic pathogen Microbotryum silenes‐inflatae

Contact Info

Product

Resources

About