The Flagellar Sigma Factor FliA Regulates Adhesion and Invasion of Crohn Disease-associated Escherichia coli via a Cyclic Dimeric GMP-dependent Pathway

Abstract

The invasion of intestinal epithelial cells by the Crohn disease-associated adherent-invasive Escherichia coli (AIEC) strain LF82 depends on surface appendages, such as type 1 pili and flagella. The absence of flagella in the AIEC strain LF82 results in a concomitant loss of type 1 pili. Here, we show that flagellar regulators, transcriptional activator FlhD 2 C 2 , and sigma factor FliA are involved in the coordination of flagellar and type 1 pili synthesis. In the deletion mutants lacking these regulators, type 1 pili synthesis, adhesion, and invasion were severely decreased. FliA expressed alone in trans was sufficient to restore these defects in both the LF82-⌬flhD and LF82-⌬fliA mutants. We related the loss of type 1 pili to the decreased expression of the FliA-dependent yhjH gene in the LF82-⌬fliA mutant. YhjH is an EAL domain phosphodiesterase involved in degradation of the bacterial second messenger cyclic dimeric GMP (c-di-GMP). Increased expression of either yhjH or an alternative c-di-GMP phosphodiesterase, yahA, partially restored type 1 pili synthesis, adhesion, and invasion in the LF82-⌬fliA mutant. Deletion of the GGDEF domain diguanylate cyclase gene, yaiC, involved in c-di-GMP synthesis in the LF82-⌬fliA mutant also partially restored these defects, whereas overexpression of the c-di-GMP receptor YcgR had the opposite effect. These findings show that in the AIEC strain LF82, FliA is a key regulatory component linking flagellar and type 1 pili synthesis and that its effect on type 1 pili is mediated, at least in part, via a c-di-GMP-dependent pathway.Many virulent bacteria, including Aeromonas caviae (1), Campylobacter jejuni (2), Clostridium difficile (3), Helicobacter pylori (4), Legionella pneumophila (5), Salmonella enterica serovar Typhimurium (6), and Vibrio cholerae (7), use flagellar motility to avoid unfavorable environments and to establish replication niches at different stages of infection. In Enterobacteriaceae, flagellar type III secretion and assembly are strictly dependent on the organization of a hierarchy that controls the sequential expression of structural and regulatory genes. In Escherichia coli and Salmonella typhimurium, the heterotetrameric transcription factor FlhD 2 C 2 (8) is positioned at the top of the flagellar expression hierarchy, where the decision to produce flagella is made (9, 10). The flhDC operon encoding FlhD 2 C 2 is transcribed from a class 1 flagellar promoter. FlhD 2 C 2 , in turn, activates 70 -dependent transcription from the class 2 flagellar promoters that drive expression of the structural subunits required for the hook-basal body structure and expression of regulatory subunits (10, 11). One of these regulatory subunits, 28 or FliA, is encoded by the fliAZ operon. FliA can associate with the core RNA polymerase to drive transcription of the class 3 flagellar genes (12). The activity of FliA depends on its interaction with the cytoplasmic anti-sigma factor FlgM, which inhibits the FliA-RNA polymerase association until completion of the hook-basal bo...

Ribonucleotide Reductase NrdR as a Novel Regulator for Motility and Chemotaxis during Adherent-Invasive Escherichia coli Infection

“…8). Flagella of the AIEC LF82 strain have established roles in the adhesion to and invasion of intestinal epithelial cells (43,44). Electronic microscopy analysis of the wild-type and LF82 ⌬nrdR isogenic mutant demonstrated reduced flagellar expression when the nrdR gene was attenuated.…”

“…It is well described that flagella contribute to AIEC virulence. Indeed, the nonmotile aflagellar LF82 mutants (⌬fliC or ⌬fliA mutants) exhibit a drastic reduction in adherence and invasion ability (43,44), and the flagellar sigma factor FliA regulates the adhesion and invasion of Crohn's disease-associated Escherichia coli via a cyclic dimeric GMP-dependent pathway (44). In addition, Crohn's disease-associated virulent AIEC LF82 bacteria, via flagellar expression, are able to potentiate an inflammatory mucosal immune response in the dextran sulfate sodium (DSS)-injured colons of BALBc/J mice via increased expression of Toll-like receptor 5 (TLR5) and IPAF flagellin receptors (45).…”

Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger

“…Expression of type 1 pili partially requires the PDE YhjH and is inhibited by the DGC AdrA (336). Type 1 pilus expression was stimulated by low c-di-GMP levels.…”

SciN Is an Outer Membrane Lipoprotein Required for Type VI Secretion in EnteroaggregativeEscherichia coli

“…Oligonucleotides used in this study were 5Ј-GATG CGCCTGGGTTACGGCGAAGGGCGGTAGCGTGCCTGACGGTCTCCT GACAGTGATGTGTAGGCTGGAGCTGCTTCG and 5Ј-GCCTTCTTCCCT TTGATTTTTACCTGCGCCAGCGTCCTGATTTCTGCCATAGCCGGTCA TATGAATATCCTCCTTAGTTC for deletion of the sciG (clpV) gene and 5Ј-GGAACATTATCAACGTAAGGAGACTCAGGAAAATGGCGATTATC GCTGGTAAGGCTGTGTGTAGGCTGGAGCTGCTTCG and 5Ј-TCCAGC CCGCCAGTGAAATTGCCATAGAGAATTTCATAAAGGGAAGGACGC GGCATATGAATATCCTCCTTAGTTC for deletion of the sciN gene. The PCR product was then electroporated into EAEC cells carrying the pKOBEG plasmid (16), as described previously (18). Replacement of the gene by the kanamycin cassette flanked by two Flp recombinase target sequences was confirmed by PCR.…”