The effects of parasite age and intensity on variability in acanthocephalan-induced behavioural manipulation

Franceschi, Nathalie; Bauer, Alexandre; Bollache, Loı̈c; Rigaud, Thierry

doi:10.1016/j.ijpara.2008.01.003

Cited by 72 publications

(123 citation statements)

References 41 publications

Supporting

Mentioning

116

Contrasting

Order By: Relevance

“…Experimental infections were carried out following the procedure described in Franceschi et al [46] and Dianne et al [9]. Briefly, 48 h-starved males were pooled two by two in 60 ml glass dishes and allowed to feed during 48 h on a 1 cm 2 piece of elm leaf, on which 100 P. laevis eggs were deposited.…”

Section: (C) Experimental Infection Of Gammarus Pulexmentioning

confidence: 99%

See 1 more Smart Citation

Multidimensionality in host manipulation mimicked by serotonin injection

2014

View full text Add to dashboard Cite

Manipulative parasites often alter the phenotype of their hosts along multiple dimensions. 'Multidimensionality' in host manipulation could consist in the simultaneous alteration of several physiological pathways independently of one another, or proceed from the disruption of some key physiological parameter, followed by a cascade of effects. We compared multidimensionality in 'host manipulation' between two closely related amphipods, Gammarus fossarum and Gammarus pulex, naturally and experimentally infected with Pomphorhynchus laevis (Acanthocephala), respectively. To that end, we calculated in each host-parasite association the effect size of the difference between infected and uninfected individuals for six different traits (activity, phototaxis, geotaxis, attraction to conspecifics, refuge use and metabolic rate). The effects sizes were highly correlated between host-parasite associations, providing evidence for a relatively constant 'infection syndrome'. Using the same methodology, we compared the extent of phenotypic alterations induced by an experimental injection of serotonin (5-HT) in uninfected G. pulex to that induced by experimental or natural infection with P. laevis. We observed a significant correlation between effect sizes across the six traits, indicating that injection with 5-HT can faithfully mimic the 'infection syndrome'. This is, to our knowledge, the first experimental evidence that multidimensionality in host manipulation can proceed, at least partly, from the disruption of some major physiological mechanism.

show abstract

Section: (C) Experimental Infection Of Gammarus Pulexmentioning

confidence: 99%

“…Behavioural consequences of infection were investigated approximately four weeks after the parasite stage infective to the definitive host had been reached (late cystacanth stage, i.e. approximately 14 weeks after experimental infection), at which time behavioural 'manipulation' is fully expressed [9,46].…”

Section: (C) Experimental Infection Of Gammarus Pulexmentioning

confidence: 99%

Multidimensionality in host manipulation mimicked by serotonin injection

2014

View full text Add to dashboard Cite

show abstract

“…The whole ITS1 gene can be amplified for molecular discrimination of P. tereticollis and P. laevis by a simple PCR assay, with the BD1 forward primer (5'GTCGTAACAAGGTTTCCGTA3') (Králová-Hromadová et al, 2003), and a reverse primer designed in a conserved 3' region of the 5.8S rRNA (AC/ITS1r : 5'TTGCGAGCCAAGTGATTCAC3'), at 50°C annealing temperature. The amplification products from P. tereticollis and P. laevis specimens can be visualized in a 2 % agarose gel at about 350 bp and 320 bp respectively (Franceschi et al, 2008).…”

Section: Molecular Characterizationmentioning

confidence: 99%

Resurrection of Pomphorhynchus tereticollis (Rudolphi, 1809) (Acanthocephala: Pomphorhynchidae) based on new morphological and molecular data

2011

View full text Add to dashboard Cite

Pomphorhynchus tereticollis (Rudolphi, 1809) is here redescribed on the basis of Rudolphi’s material, deposited in the Museum für Naturkunde Berlin, and on acanthocephalans recently collected from the type host Platichthys flessus (L.) and the region embodying the type locality. Out of the paratypes of P. tereticollis, the lectotype and paralectotypes have been designated. Their morphology fits well with that of newly collected material of P. tereticollis dissected from the type fish host from the Baltic coast near Stralsund. The resurrection of P. tereticollis, previously considered a synonym of Pomphorhynchus laevis (Zoega in Müller, 1779), is supported by several morphological features distinguishing the two Pomphorhynchus species: 1. The basal parts of the proboscis hooks located on the posterior proboscis half possess proximal projections in P. tereticollis but not in P. laevis. This shape of the hook bases is clearly visible only in unfixed fresh worms; 2. The last hooks are situated at the anterior part of the bulbus or rarely at the posterior-most end of the proboscis in P. tereticollis, while they lie anterior to the end of the proboscis in P. laevis; 3. The proboscis hooks No. 5 or 6 are markedly stout (robust) and clearly distinct in comparison with the surrounding hooks in P. tereticollis, while less robust and more similar to the hooks in P. laevis. In addition, genetic divergence between P. tereticollis and P. laevis based on ITS1, ITS2 and COI sequencing supports the existence of two distinct species and reveals that some isolates previously identified as P. laevis were actually P. tereticollis. Previous and present morphological and genetic data show that both Pomphorhynchus species occur in freshwaters throughout Europe and may infect the same fish hosts, such as chub and barbel, and also several species of isopods (Gammaridae). This study also provides morphological evidence that Pomphorhynchus intermedius Engelbrecht, 1957 is a synonym of P. tereticollis, because the only discrimination character of the former species, the “existing but small proximal projections of basal parts of the proboscis hooks located on the posterior proboscis half” are present also in P. tereticollis.

show abstract

“…In addition, the larvae do not induce behavioral alterations from the start of the infection. It is only after a few weeks, when the cysts are mature and infective to the definitive hosts, that the behavioral responses are changed [acanthocephalans (see Bethel and Holmes, 1974); cestodes (Franceschi et al, 2008); trematodes (Helluy, 1982)]. Therefore, the parasites are modulating host behavior with precise timing and in very subtle ways (Helluy and Holmes, 2005).…”

Section: Characterization Of Altered Sensorimotor Pathways Induced Bymentioning

confidence: 99%

Parasite-induced alterations of sensorimotor pathways in gammarids: collateral damage of neuroinflammation?

Helluy

2013

Journal of Experimental Biology

View full text Add to dashboard Cite

The effects of parasite age and intensity on variability in acanthocephalan-induced behavioural manipulation

Cited by 72 publications

References 41 publications

Multidimensionality in host manipulation mimicked by serotonin injection

Multidimensionality in host manipulation mimicked by serotonin injection

Resurrection of Pomphorhynchus tereticollis (Rudolphi, 1809) (Acanthocephala: Pomphorhynchidae) based on new morphological and molecular data

Parasite-induced alterations of sensorimotor pathways in gammarids: collateral damage of neuroinflammation?

Contact Info

Product

Resources

About