The Duplicated<i>Saccharomyces cerevisiae</i>Gene<i>SSM1</i>Encodes a Eucaryotic Homolog of the Eubacterial and Archaebacterial L1 Ribosomal Proteins

Petitjean, A M; Bonneaud, Nathalie; Lacroute, François

doi:10.1128/mcb.15.9.5071

Cited by 58 publications

(50 citation statements)

References 69 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As previously shown, Pab1p was found throughout the gradient as both a soluble and a polysome-associated protein (24). Ssm1p, a 60S ribosomal subunit protein (33), was detected in fractions containing the free 60S subunit and in the polysomes. Nam1p, a mitochondrial contaminant, was present essentially in the upper fractions with the soluble proteins.…”

Section: Resultsmentioning

confidence: 56%

“…Polysome extracts were prepared as previously described from cells grown to an optical density at 600 nm (OD 600 ) of between 0.6 and 0.8 and clarified by centrifugation at 20,000 ϫ g for 20 min. Extracts were fractionated through 5 to 50% sucrose gradients by centrifugation at 39,000 rpm, for 3 h, at 4°C in a Beckman SW41 rotor and analyzed by monitoring the A 260 (33). Cycloheximide was omitted from the culture medium before cell harvesting, and the extraction buffer and sucrose gradients were as indicated in the text below.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Deletion of the PAT1 Gene Affects Translation Initiation and Suppresses a PAB1 Gene Deletion in Yeast

Wyers

Minét

Dufour

et al. 2000

Molecular and Cellular Biology

View full text Add to dashboard Cite

The yeast poly(A) binding protein Pab1p mediates the interactions between the 5 cap structure and the 3 poly(A) tail of mRNA, whose structures synergistically activate translation in vivo and in vitro. We found that deletion of the PAT1 (YCR077c) gene suppresses a PAB1 gene deletion and that Pat1p is required for the normal initiation of translation. A fraction of Pat1p cosediments with free 40S ribosomal subunits on sucrose gradients. The PAT1 gene is not essential for viability, although disruption of the gene severely impairs translation initiation in vivo, resulting in the accumulation of 80S ribosomes and in a large decrease in the amounts of heavier polysomes. Pat1p contributes to the efficiency of translation in a yeast cell-free system. However, the synergy between the cap structure and the poly(A) tail is maintained in vitro in the absence of Pat1p. Analysis of translation initiation intermediates on gradients indicates that Pat1p acts at a step before or during the recruitment of the 40S ribosomal subunit by the mRNA, a step which may be independent of that involving Pab1p. We conclude that Pat1p is a new factor involved in protein synthesis and that Pat1p might be required for promoting the formation or the stabilization of the preinitiation translation complexes.Translational control of gene expression operates most frequently during the initiation phase of protein synthesis. The recruitment of the 43S preinitiation complex (40S ribosomal subunit, initiator methionyl-tRNA, and initiation factors) by the capped 5Ј end of mRNA and the scanning of the 5Ј untranslated region until the initiator codon is found are the main rate-limiting steps (for a review, see reference 28). Studies of the yeast Saccharomyces cerevisiae implicate 3Ј poly(A) tails in the joining of the 40S ribosomal subunits to the 5Ј end of mRNA (19,42). The two mRNA ends are brought together by specific protein-protein interactions. The multicomponent eukaryotic initiation factor 4F (eIF4F) initiation complex binds to the cap through the eIF4E subunit, and the eIF4G subunit acts as a bridge both between eIF4F and the 40S ribosomal subunit and between the 5Ј and 3Ј ends of mRNA through specific interactions with the Pab1p, which is associated with the poly(A) tails (16,47). Thus, a capped and polyadenylated RNA can be made circular in the presence of an eIF4E-eIF4G-Pab1p complex (52). This is consistent with the model in which mRNA forms a closed loop to facilitate translation initiation (19). The interactions between the two mRNA ends result in a synergistic enhancement of protein synthesis in vivo and in vitro (10,46,48). Moreover, this synergy is essential for translation in vitro when mRNAs compete each other for ribosome binding and when neither the cap structure nor the poly(A) tail alone is able to promote efficient protein synthesis (34, 35). Thus poly(A)-associated Pab1p is necessary for the stimulation of translation initiation and for the recruitment of the 40S ribosomal subunit by the mRNA.Pab1p also has an essential function...

show abstract

Section: Resultsmentioning

confidence: 56%

Section: Methodsmentioning

confidence: 99%

Deletion of the PAT1 Gene Affects Translation Initiation and Suppresses a PAB1 Gene Deletion in Yeast

Wyers

Minét

Dufour

et al. 2000

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…4B). Although RPL1A encodes the identical protein, it is expressed at much lower levels (Petitjean et al 1995), and the rpl1a-Δ mutant does not exhibit this phenotype (data not shown). …”

Section: Read-through Of Cga Codons Is Improved By Treatment With Parmentioning

confidence: 99%

Translation of CGA codon repeats in yeast involves quality control components and ribosomal protein L1

Letzring

Wolf

Brule

et al. 2013

RNA

107

145

View full text Add to dashboard Cite

Translation of CGA codon repeats in the yeast Saccharomyces cerevisiae is inefficient, resulting in dose-dependent reduction in expression and in production of an mRNA cleavage product, indicative of a stalled ribosome. Here, we use genetics and translation inhibitors to understand how ribosomes respond to CGA repeats. We find that CGA codon repeats result in a truncated polypeptide that is targeted for degradation by Ltn1, an E3 ubiquitin ligase involved in nonstop decay, although deletion of LTN1 does not improve expression downstream from CGA repeats. Expression downstream from CGA codons at residue 318, but not at residue 4, is improved by deletion of either ASC1 or HEL2, previously implicated in inhibition of translation by polybasic sequences. Thus, translation of CGA repeats likely causes ribosomes to stall and exploits known quality control systems. Expression downstream from CGA repeats at amino acid 4 is improved by paromomycin, an aminoglycoside that relaxes decoding specificity. Paromomycin has no effect if native tRNA Arg(ICG) is highly expressed, consistent with the idea that failure to efficiently decode CGA codons might occur in part due to rejection of the cognate tRNA Arg(ICG) . Furthermore, expression downstream from CGA repeats is improved by inactivation of RPL1B, one of two genes encoding the universally conserved ribosomal protein L1. The effects of rpl1b-Δ and of either paromomycin or tRNA Arg(ICG) on CGA decoding are additive, suggesting that the rpl1b-Δ mutant suppresses CGA inhibition by means other than increased acceptance of tRNA Arg(ICG) . Thus, inefficient decoding of CGA likely involves at least two independent defects in translation.

show abstract

“…Ten picomoles of oligonucleotide 8238, GATGTTCAAACAACCTGGGC, or 1834 (29) was 5Ј end labeled with 25 Ci of g-32P ATP by using T4 polynucleotide kinase. The hybridization was performed at 37°C for 12 h. The membrane was washed three times for 5 min at 25°C and for 15 min at 42°C.…”

Section: Methodsmentioning

confidence: 99%

Functional Analysis of Rrp7p, an Essential Yeast Protein Involved in Pre-rRNA Processing and Ribosome Assembly

Baudin-Baillieu

Tollervey

Cullin

et al. 1997

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

During the functional analysis of open reading frames (ORFs) identified during the sequencing of chromosome III of Saccharomyces cerevisiae, the previously uncharacterized ORF YCL031C (now designated RRP7) was deleted. RRP7 is essential for cell viability, and a conditional null allele was therefore constructed, by placing its expression under the control of a regulated GAL promoter. Genetic depletion of Rrp7p inhibited the prerRNA processing steps that lead to the production of the 20S pre-rRNA, resulting in reduced synthesis of the 18S rRNA and a reduced ratio of 40S to 60S ribosomal subunits. A screen for multicopy suppressors of the lethality of the GAL::rrp7 allele isolated the two genes encoding a previously unidentified ribosomal protein (r-protein) that is highly homologous to the rat r-protein S27. When present in multiple copies, either gene can suppress the lethality of an RRP7 deletion mutation and can partially restore the ribosomal subunit ratio in Rrp7p-depleted cells. Deletion of both r-protein genes is lethal; deletion of either single gene has an effect on pre-rRNA processing similar to that of Rrp7p depletion. We believe that Rrp7p is required for correct assembly of rpS27 into the preribosomal particle, with the inhibition of pre-rRNA processing appearing as a consequence of this defect.The biosynthesis of eukaryotic ribosome is a complex process that occurs in a subnuclear organelle: the nucleolus (for reviews, see references 15 and 32). In the yeast Saccharomyces cerevisiae, between 100 and 200 copies of the rRNA gene (rDNA) are present on chromosome XII. Each repeated transcription unit is transcribed by RNA polymerase I into a 7-kb, 35S primary transcript that contains the 18S, 5.8S, and 25S rRNA sequences separated by internal transcribed spacers (ITS) and flanked by external transcribed spacers (ETS). The 35S transcript undergoes a complex series of cleavages and trimming reactions that remove the spacer regions, releasing the three mature rRNA species. The early steps in pre-rRNA processing, cleavage at sites A 0 , A 1 , and A 2 , separate the 20S pre-rRNA from the 27SA 2 pre-rRNA. 20S pre-rRNA is the precursor to the 18S rRNA which is incorporated into the 40S ribosomal subunit, while 27SA 2 contains the 5.8S and 25S rRNAs which are destined to form the 60S subunit. In many cases, mutations affect only the processing reactions on either the pathway of 18S synthesis or the pathway of 5.8S-25S synthesis (38).During the pre-rRNA processing events, many of the approximately 80 ribosomal proteins assemble onto the rRNA, but little detailed knowledge is available on the assembly pathway in eukaryotes. Mutations in r-protein genes lead to the inhibition of synthesis of the subunit of which they are components, presumably as a consequence of defects in subunit assembly (40). Ribosomal proteins L1 and rp59 are necessary for production of the 60S and the 40S subunits, respectively (11, 23), as well as the UBI1 to UBI3 genes that encode ribosomal proteins (12), while a mutation in the ribosomal ...

show abstract

The DuplicatedSaccharomyces cerevisiaeGeneSSM1Encodes a Eucaryotic Homolog of the Eubacterial and Archaebacterial L1 Ribosomal Proteins

Cited by 58 publications

References 69 publications

Deletion of the PAT1 Gene Affects Translation Initiation and Suppresses a PAB1 Gene Deletion in Yeast

Deletion of the PAT1 Gene Affects Translation Initiation and Suppresses a PAB1 Gene Deletion in Yeast

Translation of CGA codon repeats in yeast involves quality control components and ribosomal protein L1

Functional Analysis of Rrp7p, an Essential Yeast Protein Involved in Pre-rRNA Processing and Ribosome Assembly

Contact Info

Product

Resources

About