The development of a PCR-based marker linked to resistance to the blackcurrant gall mite (Cecidophyopsis ribis Acari: Eriophyidae)

Abstract

Gall mite (Cecidophyopsis ribis) is the most serious pest of blackcurrant (Ribes nigrum L.), causing the damaging condition known as 'big bud' and also transmitting blackcurrant reversion virus (BRV) within and between plantations. The identification of resistant germplasm is at present a time-consuming and expensive process, dependent on field infestation plots. Resistance based on gene Ce introgressed from gooseberry has been used in UK breeding programmes for blackcurrant. Using a bulked segregant analysis, 90 AFLP primer combinations were screened and a linkage map constructed around the resistance locus controlled by Ce. Sixteen of the primer combinations produced a fragment in the resistant bulked progeny and the gall mite-resistant parent, but not in the susceptible bulked progeny and parent; subsequent testing on individual progeny identified an AFLP fragment closely linked to gall mite resistance. This fragment, designated E41M88-280, was converted to a PCR-based marker based on sequence-specific primers, amplifying only in resistant individuals. Validation of this marker across a range of susceptible and resistant blackcurrant germplasm with different genetic backgrounds confirmed its reliability in the identification of mite-resistant germplasm containing gene Ce. The conversion of an AFLP fragment to a sequence-based PCR marker simplifies its application and therefore increases its utility for selection of mite-resistant germplasm in high-throughput breeding programmes for blackcurrant.

Genetic background of resistance to gall mite in Ribes species

“…1 A), using a molecular marker developed by Brennan et al (2009). The analysis established that PCR product of expected size was identified in gooseberry 'Bedford Yellow' characteristic of the marker of gene Ce.…”

“…Ce gene was identified using a molecular marker based on sequence of AFLP fragment (Brennan et al 2009). Primer set 5'TTGAGACCTCCAAGTCCTGCT3' and 5'CTTGGCTTCGTTGTTAGATGC3' for PCR fragment in 180 bp length was used.…”

“…Species from genus Ribes -R. americanum, R. nigrum spp. sibiricum, R. uva-crispa, R. aureum, R. sanguineum, have been used as donors of resistance to various R. nigrum diseases and pests (Stanys et al 2004, Siksnianas et al 2005, Rubauskis et al 2006, Brennan et al 2009). However, genetic background of resistance to gall mite in species R. americanum, R. aureum, R. dikusha and R. sanguineum still remains unknown.…”

The control of eriophyoid mites: state of the art and future challenges

“…Kahu et al (2009) evaluated a number of blackcurrant cultivars in terms of productivity and berry quality, and found that some of them exhibited some resistance to the C. ribis. Brennan et al (2009) developed a PCR-based marker potentially useful for the identification of mite-resistant germplasm. They validated this marker on susceptible and resistant germplasm in the framework of blackcurrant breeding programs.…”

A new eriophyoid mite species (Acari: Eriophyidae) infesting <i>Haloxylon ammodendron</i> and <i>H. persicum</i> (Chenopodiaceae) in Xinjiang Uigur Autonomous Region, northwest China

“…More than a fourth of Eriophyidae species form galls on plant leaves, buds, short stems, and flowers (Keifer et al 1982). For example, A kind of gall mite (Cecidophyopsis ribis Acari: Eriophyidae) causes the damaging condition known as "big bud" which is the most serious pest of blackcurrant (Ribes nigrum L.) (Brennan et al 2009). A. carvi Nal.…”