The Deubiquitinase USP9X Maintains DNA Replication Fork Stability and DNA Damage Checkpoint Responses by Regulating CLASPIN during S-Phase

Abstract

Coordination of the multiple processes underlying DNA replication is key for maintaining genome stability and preventing tumorigenesis. CLASPIN, a critical player in replication fork stabilization and checkpoint responses, must be tightly regulated during the cell cycle to prevent the accumulation of DNA damage. In this study, we used a quantitative proteomics approach and identified USP9X as a novel CLASPIN-interacting protein. USP9X is a deubiquitinase involved in multiple signaling and survival pathways whose tumor suppressor or oncogenic activity is highly context dependent. We found that USP9X regulated the expression and stability of CLASPIN in an S-phase-specific manner. USP9X depletion profoundly impairs the progression of DNA replication forks, causing unscheduled termination events with a frequency similar to CLASPIN depletion, resulting in excessive endogenous DNA damage. Importantly, restoration of CLASPIN expression in USP9X-depleted cells partially suppressed the accumulation of DNA damage. Furthermore, USP9X depletion compromised CHK1 activation in response to hydroxyurea and UV, thus promoting hypersensitivity to drug-induced replication stress. Taken together, our results reveal a novel role for USP9X in the maintenance of genomic stability during DNA replication and provide potential mechanistic insights into its tumor suppressor role in certain malignancies. Cancer Res; 76(8); 2384-93. Ó2016 AACR.

Targeting the overexpressed USP7 inhibits esophageal squamous cell carcinoma cell growth by inducing NOXA‐mediated apoptosis

“…11668019, Thermo Fisher Scientific). In Figure and , cells were transfected with siRNA for 48 h and further treated with P5091 for 48 h. In Figure , cells transfected with siRNAs were collected after 96 h. The sequences of the siRNA are as follows: siNOXA‐1 : GUAAUUAUUGACACAUUUC; siNOXA‐2: GGUGCACGUUUCAUCAAUUUG; siUSP7‐1: ACCCUUGGACAAUAUUCCU; siUSP7‐2: AGUCGUUCAGUCGUCGUAU; siUSP7‐3: UGACGUGUCUCUUGAUAAA; siATF4: GCCUAGGUCUCUUAGAUGA; siControl: UUCUCCGAACGUGUCACGU.…”

Deubiquitylating enzymes and drug discovery: emerging opportunities

“…USP9X 21 , which maintains DNA replication fork stability and DNA damage checkpoint responses by regulating the protein claspin during S phase 84 , may represent another potential therapeutic target. USP9X has been shown to affect radiosensitivity in glioblastoma cells by myeloid cell leukaemia 1 (MCL1)-dependent and -independent mechanisms 85 .…”

The Deubiquitinating Enzyme USP37 Stabilizes CHK1 to Promote the Cellular Response to Replication Stress

“…CHK1 activity is tightly regulated on multiple levels including the degradation of active CHK1 or of the upstream factor CLASPIN by the UPS (Bassermann et al, 2008;Faustrup et al, 2009;Gao et al, 2009;Huh and Piwnica-Worms, 2013;Leung-Pineda et al, 2009;Mailand et al, 2006;Mamely et al, 2006;Peschiaroli et al, 2006;Yuan et al, 2014;Zhang et al, 2009;Zhang et al, 2005;Zhu et al, 2014). Whereas multiple DUBs regulate CLASPIN, only two, USP1 and USP7, have been implicated in regulation of CHK1 (Bassermann et al, 2008;Faustrup et al, 2009;Martin et al, 2015;McGarry et al, 2016;Yuan et al, 2014;Zhang et al, 2006;Zhu et al, 2014). Intriguingly, regulation of CHK1 by these DUBs may be context specific.…”

“…Additionally, the E3 ligases, HERC2 and BRCA1, have also been demonstrated to ubiquitinate CLASPIN (Sato et al, 2012;Yuan et al, 2014;Zhu et al, 2014). Further underscoring the need for tight control of CHK1 activation, multiple deubiquitinating enzymes (DUBs), including USP7, USP9x, USP28, and USP29, enhance CHK1 activation by stabilizing CLASPIN, whereas several recent reports demonstrate that USP20 promotes CHK1 function by stabilizing both RAD17 and CLASPIN (Bassermann et al, 2008;Faustrup et al, 2009;Martin et al, 2015;McGarry et al, 2016;Shanmugam et al, 2014;Yuan et al, 2014;Zhang et al, 2006;Zhu et al, 2014). CHK1 itself is also targeted for destruction.…”