The delta-crystallin enhancer-binding protein delta EF1 is a repressor of E2-box-mediated gene activation.

Abstract

The repressor 8EF1 was discovered by its action on the DC5 fragment of the lens-specific 81-crystallin enhancer. C-proximal zinc fingers of 8EF1 were found responsible for binding to the DC5 fragment and had specificity to CACCT as revealed by selection of high-affinity binding sequences from a random oligonucleotide pool. CACCT is present not only in DC5 but also in the E2 box (CACCTG) elements which are the binding sites of various basic helix-loop-helix activators and also the target of an unidentified repressor, raising the possibility that 8EF1 accounts for the E2 box repressor activity. 8EF1 competed with E47 for binding to an E2 box sequence in vitro. In lymphoid cells, endogenous 8EF1 activity as a repressor was detectable, and exogenous 8EF1 repressed immunoglobulin K enhancer by binding to the KE2 site. Moreover, bEF1 repressed MyoD-dependent activation of the muscle creatine kinase enhancer and MyoD-induced myogenesis of 1OT1/2 cells. Thus, 8lEF1 counteracts basic helix-loop-helix activators through binding site competition and fulfills the conditions of the E2 box repressor. In embryonic tissues, the most prominent site of &;EF1 expression is the myotome. Myotomal expression as well as the above results argues for a significant contribution of 6EF1 in regulation of embryonic myogenesis through the modulation of the actions of MyoD family proteins.Cumulative evidence has indicated that repressors interacting with activators play crucial roles in developmental gene regulation. In the best-studied cases of transcriptional regulatory elements generating developmental specificities, it is found that a binding site of a repressor overlaps with a binding site of an activator so that the regulators of the opposite effects compete for occupancy of the same site (16,28,29,32). In general, the repressor is more widely distributed in spatial and temporal terms than the activators. Thus, in the majority of cell types the repressor occupies the element and shuts off expression of the gene, and only under conditions in which binding of the activator to the element dominates over that of the repressor is expression of the gene turned on. This seems one of the basic mechanisms to elicit stage-specific or cell-typespecific gene expression.An example is found in immunoglobulin enhancers in which E2 box activator binding sites with the core sequence of CACCTG have been identified. A group of basic helix-loophelix (bHLH) activator proteins (25) which are encoded by E2A and E2-2 genes (3) and bind to the E2 site of the immunoglobulin K enhancer (and the ,uE5 site of the immunoglobulin heavy-chain enhancer as well) are in competition with a repressor, and only in differentiated lymphoid cells is the action of the activator effectuated and immunoglobulin K enhancer activated (29). The same scenario holds true for regulatory elements of myocyte-specific genes such as AChRb in which activators containing myogenic MyoD family proteins as their component bind to an E2-box-activating element (32). In these cases, action of the r...

Two mechanisms in the action of repressor δEF1: binding site competition with an activator and active repression

“…1), binds CACCT-containing DNA, while the DC-fin form of dEF1 does not (Sekido et al 1994). From this result, we thought that C-fin was the major binding domain of the dEF1 molecule.…”

Complementary expression pattern of Zfhx1 genes Sip1 and δEF1 in the mouse embryo and their genetic interaction revealed by compound mutants

“…In vertebrates, Zfhx1 proteins are classified as either ␦EF1 or Sip1. Functional analyses of ␦EF1 and Sip1 proteins from mouse and chicken have demonstrated their similarities: binding to an identical consensus sequence CACCT and acting as transcriptional repressors when bound (Sekido et al, 1994Remacle et al, 1999), by a mechanism involving the binding of co-repressor CtBP (Furusawa et al, 1999;van Grunsven et al, 2003). These proteins also participate in gene activation in other contexts (Lazarova et al, 2001;Dillner and Sanders, 2004;Yoshimoto et al, 2005).…”

Evidence for a function of CtBP in epithelial gene regulation and anoikis

“…We found that the E1a ± CtBP interaction was required for the induction of epithelial gene expression. In the case of the E-cadherin promoter, this resulted from E1a's disruption of a complex involving CtBP and dEF1/ZEB, a zinc ®nger-homeodomain repressor protein (Sekido et al, 1994) that controls muscle and lymphoid di erentiation (Sekido et al, 1994;Higashi et al, 1997;. Anoikis-sensitivity resulted from the E1a ± CtBP interaction as well.…”

“…The zinc ®nger-homeodomain repressor dEF1/ZEB binds E-boxes Rb-family Corbeil and Branton, 1994 D1 ± 140 p300, CBP, P/CAF, Rb Wang et al, 1993;Reid et al, 1998;Corbeil andBranton, 1994 D81 ± 243* Rb-family, CtBP Wang et al, 1993;Reid et al, 1998;Corbeil and Branton, 1994D202 ± 243 CtBP Boyd et al, 1993233PL?AS CtBP Boyd et al, 1993; this study *A C-terminal nuclear localization signal and HA-tag were appended to this coding sequence E1a mutants used in this study were previously characterized as indicated in the references, except the 233PL?AS mutant, which was shown to prevent the interaction of E1a with CtBP as follows. Gst-CtBP protein (2 mg; lanes 2 ± 4) or gst protein (lane 1) immobilized on glutathionesepharose was reacted in bu er containing 200 mM NaCl and 0.25% Triton X-100 with in vitro translated E1a wild-type (lanes 1 and 2), E1a P233A (lane 3) or E1a 233PL?AS (lane 4), washed and analysed by PAGE (Sekido et al, 1994;Remacle et al, 1999) and represses transcription by recruiting CtBP (Postigo and Dean, 1999). We therefore tested its potential as an Ecadherin repressor.…”

“…Nuclear extracts from HT1080 ®brosarcoma cells were prepared as described previously (Frisch and Morisaki, 1990) and were analysed for gel electrophoretic mobility shift using E-cadherin promoter oligonucleotides containing wild-type (wt: TGGCCGGCAGGTGAACCCTCAGTTAATCAGCGGTATAAAAAATGGTGCTCTAAAATTCACCTGGCTG-CAG) or mutant (mut: TGGCCGGAAGATGAACCCTCAGTTAATCAGCGGTATAAAAAATGGTGCTCTAAAAT-TAACTTGGCTGCAG) E-boxes under conditions described (Sekido et al, 1994). Anti-dEF1/ZEB antibody was from Dr H Kondoh (Sekido et al, 1994); 1 ml of it or pre-immune serum (p.i.) containing 50% glycerol were pre-incubated with 2 ml of nuclear extract (*6 mg) for 15 min at 48 prior to electrophoresis.…”