The complete sequence of a cucumber mosaic virus from Ixora that is deficient in the replication of satellite RNAs

Abstract

A cucumber mosaic virus (CMV-Ix) from Ixora is unusual in that it does not support the accumulation of some well-characterized CMV satellite RNAs in plants. CMV-Ix can support a particular satellite RNA variant which causes lethal tomato necrosis when inoculated with other CMV strains but not when inoculated with CMV-Ix. This difference in ability to support accumulation of specific satellite variants is apparent even when their sequences differ by only 10 nucleotides. Electroporation of tomato protoplasts with combinations of CMV-Ix or CMV-1 RNA plus the same satellite variants showed similar differences in accumulation, indicating a defect in satellite RNA replication and not movement or encapsidation. Pseudorecombinant virus infections between CMV-1 and CMV-Ix indicated that the genomic determinants responsible for this phenotype reside on RNA 1 since only combinations with CMV-Ix RNA 1 failed to replicate satellite RNA. The complete genome of CMV-Ix was cloned, sequenced and compared with the genomes of other cucumoviruses. CMV-Ix is most similar in RNA and protein sequence to subgroup 1 CMV-Fny and CMV-Y but slightly less similar than they are to each other. CMV-Ix and all cucumovirus strains sequenced thus far share a domain in the 3' untranslated portion of their genomic RNAs in which 39 of 40 bases are completely conserved.

Biological and Molecular Characterization of Cucumber mosaic virus Isolate Causing Shoestring Disease of Tomato in India which has Closer Affinity to European or East Asian Isolates of CMV

“…presence of conserved TG tract in 5 0 UTR (as reported earlier by Boccard and Baulcombe [1], the motif 'CAA CAG TCC TC' and GGT TCA ATT CC in the 3a and IR gene, respectively and a highly conserved region 'TCC AGC TTA CGG CTA AAA TGG TCA GTC G' in 3 0 UTR, like in other strains of CMV strains was also obtained [10]. However, no substitutions were observed in 5 0 UTR and IR regions.…”

Evidence for the occurrence of two distinct subgroups of peanut stunt cucumovirus strains: molecular characterization of RNA3.

“…7 a). Although the similarity scores for cucumovirus 3a proteins recently reported by McGarvey et al (1995) showed sequence relationships among the cucumoviruses comparable to those deduced in the present study, they were generally lower in magnitude. The higher values obtained in our study may be explained by the fact that we employed the GAP program, which considers all possible alignments and gap positions and creates the alignment of two complete sequences with the largest number of matched bases and the fewest gaps ; the similarity scores calculated by McGarvey et al (1995) were based on global alignments of multiple sequences using the CLUSTAL algorithm with fixed gap positions.…”

“…Like other cucumoviruses, the 3h UTRs of PSV-W and PSV-ER RNA3s contain the 40 nt sequence domain conserved in all cucumovirus RNAs so far examined (Figs 3 and 4, underlined). This highly conserved sequence, which is important for RNA3 accumulation (Boccard & Baulcombe, 1993 ;McGarvey et al, 1995), may be exploited in designing universal probes for the detection and diagnosis of cucumovirus infections and also in designing universal primers for cDNA synthesis and cloning of cucumovirus RNAs. It is of interest to note that the only known variant nucleotide (arrowhead above sequence in the 3h UTR, Figs 3 and 4) in this highly conserved 40 nt sequence (McGarvey et al, 1995) is different for each of the three PSV strains : G for strain W, U for strain ER and A for strain J.…”

Nucleotide sequence analyses of genomic RNAs of Peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

“…The 5 UTR of PSV RNA3, like those of all other cucumoviruses, contains the conserved UG tract (5 GUGUUGUUGUUGGU3 ) that is required for efficient accumulation of RNA3 [1]. Like other members of the genus Cucumovirus, the 3 UTRs of RNA1, 2 and 3 of PSV-Mi are highly conserved and contain a 40 nt sequence (5 GATCGGGTTGTCCATCCAGCTAACGGCTAAAATGGTCAGT3 ) conserved in all Cucumovirus RNAs, which is also important for RNA accumulation [10]. Among the UTR's, the 5 UTRs of RNA1 and 2 of all PSV strains are most conserved as the 5 UTR of PSV-Mi RNA1 and 2 were 83.5 ∼ 96.1% identical to those of the PSV-ER and W strains whereas the 5 UTR of RNA3 had only 78.4 ∼ 79.8% identity with the 5 UTR of RNA3 to PSV-ER and W (PSV-ER and -W share over 90% identity in this region).…”