The Comparative Utility of Viromer RED and Lipofectamine for Transient Gene Introduction into Glial Cells

Rao, Shobini L.; Morales, Alejo; Pearse, Damien D.

doi:10.1155/2015/458624

Cited by 22 publications

(15 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Before transfection, rat Schwann cells were plated on poly-L-lysine-coated plates and maintained until reaching 70% confluence. Transient transfections with WT-PMP22-Myc plasmids (Johnson et al, 2005) and scrambled or pooled rat PMP22 shRNA plasmids containing GFP reporters (Applied Biological Materials) were performed using lipofectamine 3000 (Invitrogen) in Opti-MEM medium (Thermo Fisher Scientific) (Rao et al, 2015). The sequences (from 5Ј-3Ј) of PMP22 shRNA are as follows: 40 GCGGT GCTAGTGTTGCTCTTCGTCTCCAC; 161 ACTCCTCATCTGTGAG CGAATGGCTTCAG; 313 CTTGCTGGTCTGTGTGTGATGAGTGC AGC; and 438 CCTCCTTAGTGGCATCATCTACGTGATCC.…”

Section: Methodsmentioning

confidence: 99%

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

Zhou¹,

Miles

Tavori

et al. 2019

J. Neurosci.

View full text Add to dashboard Cite

The absence of functional peripheral myelin protein 22 (PMP22) is associated with shortened lifespan in rodents and severe peripheral nerve myelin abnormalities in several species including humans. Schwann cells and nerves from PMP22 knock-out (KO) mice show deranged cholesterol distribution and aberrant lipid raft morphology, supporting an unrecognized role for PMP22 in cellular lipid metabolism. To examine the mechanisms underlying these abnormalities, we studied Schwann cells and nerves from male and female PMP22 KO mice. Whole-cell current-clamp recordings in cultured Schwann cells revealed increased membrane capacitance and decreased membrane resistance in the absence of PMP22, which was consistent with a reduction in membrane cholesterol. Nerves from PMP22-deficient mice contained abnormal lipid droplets, with both mRNA and protein levels of apolipoprotein E (apoE) and ATPbinding cassette transporter A1 (ABCA1) being highly upregulated. Despite the upregulation of ABCA1 and apoE, the absence of PMP22 resulted in reduced localization of the transporter to the cell membrane and diminished secretion of apoE. The absence of PMP22 also impaired ABCA1-mediated cholesterol efflux capacity. In nerves from ABCA1 KO mice, the expression of PMP22 was significantly elevated and the subcellular processing of the overproduced protein was aberrant. In wild-type samples, double immunolabeling identified overlapping distribution of PMP22 and ABCA1 at the Schwann cell plasma membrane and the two proteins were coimmunoprecipitated from Schwann cell and nerve lysates. Together, these results reveal a novel role for PMP22 in regulating lipid metabolism and cholesterol trafficking through functional interaction with the cholesterol efflux regulatory protein ABCA1. Significance StatementUnderstanding the subcellular events that underlie abnormal myelin formation in hereditary neuropathies is critical for advancing therapy development. Peripheral myelin protein 22 (PMP22) is an essential peripheral myelin protein because its genetic abnormalities account for ϳ80% of hereditary neuropathies. Here, we demonstrate that in the absence of PMP22, the cellular and electrophysiological properties of the Schwann cells' plasma membrane are altered and cholesterol trafficking and lipid homeostasis are perturbed. The molecular mechanisms for these abnormalities involve a functional interplay among PMP22, cholesterol, apolipoprotein E, and the major cholesterol-efflux transporter protein ATP-binding cassette transporter A1 (ABCA1). These findings establish a critical role for PMP22 in the maintenance of cholesterol homeostasis in Schwann cells.

show abstract

Section: Methodsmentioning

confidence: 99%

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

Zhou¹,

Miles

Tavori

et al. 2019

J. Neurosci.

View full text Add to dashboard Cite

show abstract

“…Cationic polyethylenimine (PEI)-DNA ‘polyplexes’ are avidly used for gene delivery (Goula et al, 1998; Rao et al, 2015). Polyamidoamines (PAMAM) and poly(lactic-co-glycolic) acid (PLGA) have also been frequently examined.…”

Section: Delivery Systemsmentioning

confidence: 99%

“…Lipid containing substances are frequently used for CNS delivery (Rao et al, 2015). Early investigations showed liposome-mediated gene delivery, i.e.…”

Section: Delivery Systemsmentioning

confidence: 99%

“…Early investigations showed liposome-mediated gene delivery, i.e. lipofection, was more efficient than calcium phosphate transfection in fetal human and rat astrocytes, and was comparable to that of modified vaccinia Ankara viral transduction in fetal spinal cord astrocytes (Ambrosini et al, 1999), and PEI in primary rat astrocytes (Rao et al, 2015). Neutrally charged, 120–150 nm liposomal NPs containing palmitic acid, vitamin A, or vitamin E preferentially transfected astrocytes close to the injection site after ICV delivery.…”

Section: Delivery Systemsmentioning

confidence: 99%

See 1 more Smart Citation

Destination Brain: the Past, Present, and Future of Therapeutic Gene Delivery

Joshi

Labhasetwar

Ghorpade

2017

J Neuroimmune Pharmacol

View full text Add to dashboard Cite

Neurological diseases and disorders (NDDs) present a significant societal burden and currently available drug- and biological-based therapeutic strategies have proven inadequate to alleviate it. Gene therapy is a suitable alternative to treat NDDs compared to conventional systems since it can be tailored to specifically alter select gene expression, reverse disease phenotype and restore normal function. The scope of gene therapy has broadened over the years with the advent of RNA interference and genome editing technologies. Consequently, encouraging results from central nervous system (CNS)-targeted gene delivery studies have led to their transition from preclinical to clinical trials. As we shift to an exciting gene therapy era, a retrospective of available literature on CNS-associated gene delivery is in order. This review is timely in this regard, since it analyzes key challenges and major findings from the last two decades and evaluates future prospects of brain gene delivery. We emphasize major areas consisting of physiological and pharmacological challenges in gene therapy, function-based selection of an ideal cellular target, available therapy modalities, and diversity of viral vectors and nanoparticles as vehicle systems. Further, we present plausible answers to key questions such as strategies to circumvent low blood-brain barrier permeability, most suitable CNS cell types for targeting. We compare and contrast pros and cons of the tested viral vectors in context of delivery systems used in past and current clinical trials. Gene vector design challenges are also evaluated in the context of cell-specific promoters. Key challenges and findings reported for recent gene therapy clinical trials, assessing viral vectors and nanoparticles, are discussed in the context of bench to bedside gene therapy translation. We conclude this review by tying together gene delivery challenges, available vehicle systems and comprehensive analysis of neuropathogenesis to outline future prospects of CNS-targeted gene therapies.

show abstract

“…However, macrophages, including microglia, are equipped with a series of cytoplasmic enzymes that degrade foreign nucleic acids, which results in low transfection efficiencies with the currently available chemical based techniques [10]. Indeed, while the cationic lipid-based transfection reagent Lipofectamine is mostly used for introducing foreign DNA in BV2 cells [11,12] the amount of viable transfected cells is considerably low [13]. Despite the benefit of gene delivery in BV2 cells, a comparative analysis of chemical transfection methods is lacking.…”

Section: Introductionmentioning

confidence: 99%