The Cellular and Synaptic Architecture of the Mechanosensory Dorsal Horn

Abraira, Victoria E.; Kuehn, Emily D.; Chirila, Anda M.; Springel, Mark W.; Toliver, Alexis A.; Zimmerman, Amanda; Orefice, Lauren L.; Boyle, Kieran A.; Bai, Lijun; Song, Bryan J.; Bashista, Karleena A.; O'Neill, Thomas G.; Justin, Zhuo; Tsan, Connie; Hoynoski, Jessica; Rutlin, Michael; Kus, Laura; Niederkofler, Vera; Watanabe, Masahiko; Dymecki, Susan M.; Nelson, Sacha B.; Heintz, Nathaniel; Hughes, David I.; Ginty, David D.

doi:10.1016/j.cell.2016.12.010

Cited by 333 publications

(515 citation statements)

References 58 publications

Supporting

Mentioning

471

Contrasting

Unclassified

Order By: Relevance

“…Utilizing TH 2a-CreER ; R26 LSL-YFP (Ai3) mice (Abraira et al, 2017) and postnatal tamoxifen injection to achieve sparse genetic labeling of sympathetic neurons and their dendrites within the SCG (Figure S4A–B), we observed the presence of P-TrkA (Y785) puncta associated with sympathetic neuron dendrites at all examined postnatal (P) ages: P7, P14, P21, and P42–P56 (Figure 5A). We note that both the number of P-TrkA (Y785) puncta (Figure 5B) and the number of synapses (immunohistochemically defined as Homer1-VAChT double positive puncta) within dendrites increase between developmental (P14) and young adult (P42–P56) ages (Figures 5C, S4C).…”

Section: Resultsmentioning

confidence: 99%

“…TrkA Flag/Flag mice (Sharma et al, 2010) were maintained homozygous on a mixed background. TH -2A-CreER (Abraira et al, 2017) heterozygous males were crossed to homozygous Rosa -CAG-LSL-EYFP-WPRE (Madisen et al, 2010) reporter mice and were genotyped for TH-2A-CreER using the following primer set which detect both mutant and wild- type alleles; TH-2A-CreER-1: CATGCCCATATCCAATCTCC, TH-2A-CreER-2: CTGGAGCGCATGCAGTAGTA, and TH-2A-CreER-3: ATGTTTAGCTGGCCCAAATG. Male and female mice were used for in vitro experiments and male mice were used for in vivo experiments.…”

Section: Extended Experimental Proceduresmentioning

confidence: 99%

See 1 more Smart Citation

Retrogradely Transported TrkA Endosomes Signal Locally within Dendrites to Maintain Sympathetic Neuron Synapses

2017

Self Cite

View full text Add to dashboard Cite

Summary Sympathetic neurons require NGF from their target fields for survival, axonal target innervation, dendritic growth and formation, and maintenance of synaptic inputs from preganglionic neurons. Target-derived NGF signals are propagated retrogradely, from distal axons to somata of sympathetic neurons via TrkA signaling endosomes. We report that a subset of TrkA endosomes that are transported from distal axons to cell bodies also translocate into dendrites, where they are signaling-competent and move bidirectionally, in close proximity to synaptic protein clusters. Using a strategy for spatially-confined inhibition of TrkA kinase activity, we found that distal axon-derived TrkA signaling endosomes are necessary specifically within sympathetic neuron dendrites for maintenance of synapses. Thus, TrkA signaling endosomes have unique functions in different cellular compartments. Moreover, target-derived NGF mediates circuit formation and synapse maintenance through TrkA endosome signaling within dendrites to promote aggregation of postsynaptic protein complexes.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Extended Experimental Proceduresmentioning

confidence: 99%

Retrogradely Transported TrkA Endosomes Signal Locally within Dendrites to Maintain Sympathetic Neuron Synapses

2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…The vibrotactile stimulation-induced medial lemniscus (ML) ascending pathway terminates in the nucleus gracilis, nucleus cuneatus, posterior lateral nucleus of the thalamus, and para-brachial nuclei (PV) 65,66. Further, some Aβ fibers, which are activated by vibrotactile stimulation, terminate in a deep layer of the dorsal horn to relay ascending information via the anterior spinothalamic (ST) pathway 67. A previous study reported that the ST ascending pathway targets not only the thalamus but also the caudal ventrolateral medulla (VLM), lateral PV, and periaqueductal gray matter (PAG) 68,69.…”

Section: Discussionmentioning

confidence: 99%

Both ipsilateral and contralateral localized vibratory stimulations modulated pain-related sensory thresholds on the foot in mice and humans

Doi¹,

Sakasaki²,

Tokunaga³

et al. 2018

JPR

View full text Add to dashboard Cite

PurposeThis study was aimed to investigate the effect of localized vibration on sensory thresholds in mice and humans using a novel quantitative method.Participants and methodsThe sensory thresholds of 7-week-old male C57BL/6J mice were measured with four sine-wave electrostimulation frequencies (5, 50, 250, and 2,000 Hz) before and after applying 2-minute vibration to the plantar side of the foot in mice. In human participants (16 males and 16 females; mean age, 21.0±0.8 years), the sensory threshold was measured at 50 Hz before and after applying 2-minute and 5-minute vibrations to the dorsal side of the foot.ResultsApplication of a 2-minute vibration at either the ipsilateral or contralateral side modulated the sensory thresholds elicited by a 5- or 50-Hz right electrostimulation in mice. In human participants, application of a 5-minute vibration at either the ipsilateral or contralateral side modulated the sensory threshold elicited by 50-Hz right electrostimulation, but had no effect on local skin temperature. These results suggest that the right side of pain-related Aδ fibers (50 Hz) or C fibers (5 Hz) was modulated by the localized ipsilateral or contralateral side of vibratory stimuli, respectively, in mice and humans.ConclusionThe ability of contralateral vibration to modify the right sensory thresholds suggests possible involvement of the central nervous system in vibratory modulation.

show abstract

“…In addition to these populations of nociceptors, some recent studies have implicated low threshold mechanoreceptors (C-LTMRs) in mediating mechanical pain to normally non-noxious stimuli in conditions of injury and chronic pain [54–56]. The C-LTMRs have been most studied within the skin.…”

Section: Initiation Of Pain Signals From the Bone And Jointmentioning

confidence: 99%

Mechanisms Underlying Bone and Joint Pain

Havelin

King

2018

Curr Osteoporos Rep

View full text Add to dashboard Cite

Purpose of Review. The goal of this review is to provide a broad overview of the current understanding of mechanisms underlying bone and joint pain. Recent Findings. Bone or joint pathology is generally accompanied by local release of pro-inflammatory cytokines, growth factors and neurotransmitters that activate and sensitize sensory nerves resulting in an amplified pain signal. Modulation of the pain signal within the spinal cord and brain that result in net increased facilitation is proposed to contribute to the development of chronic pain. Summary. Great strides have been made in our understanding of mechanisms underlying bone and joint pain that will guide development of improved therapeutic options for these patients. Continued research is required for improved understanding of mechanistic differences driving different components of bone and/or joint pain such as movement related pain compared to persistent background pain. Advances will guide development of more individualized and comprehensive therapeutic options.

show abstract

The Cellular and Synaptic Architecture of the Mechanosensory Dorsal Horn

Cited by 333 publications

References 58 publications

Retrogradely Transported TrkA Endosomes Signal Locally within Dendrites to Maintain Sympathetic Neuron Synapses

Retrogradely Transported TrkA Endosomes Signal Locally within Dendrites to Maintain Sympathetic Neuron Synapses

Both ipsilateral and contralateral localized vibratory stimulations modulated pain-related sensory thresholds on the foot in mice and humans

Mechanisms Underlying Bone and Joint Pain

Contact Info

Product

Resources

About