The carboxy‐terminal tail of connexin43 gap junction protein is sufficient to mediate cytoskeleton changes in human glioma cells

Abstract

Connexin43 (Cx43) is a ubiquitously expressed member of the gap junction protein family that mediates gap junction intercellular communication (GJIC) by allowing exchange of cytosolic materials. Previous studies have used Cx43 truncated at the cytoplasmic tail (C-tail) to demonstrate that the C-tail is essential to regulate cell growth and motility. Therefore, the aim of our study was to delineate the respective role of the truncated Cx43 and the C-tail in mediating Cx43-dependent signaling. A truncated Cx43 expressing the channel part of the protein (TrCx43, amino acid 1-242) and a construct encompassing only the C-tail from amino acid 243 (243Cx43) were transduced into LN18 human glioma cells. Our results showed that the ability of Cx43 to suppress growth was independent of GJIC as assessed by dye transfer, but was dependent on the presence of a rigid extracellular matrix. We further demonstrated that the C-tail alone is sufficient to promote motility. Surprisingly, Cx43 is also able to increase migration in the absence of the C-tail, suggesting the presence of at least two distinct signaling mechanisms utilized by Cx43 to affect motility. Finally, we used time-lapse imaging to examine the behavior of migrating cells and it was apparent that the C-tail was associated with a lamellipodia-based migration not observed in either mock or TrCx43 expressing LN18 cells. Our study shows for the first time that a free C-tail is sufficient to induce Cx43-dependent changes in cell morphology and that Cx43 signaling is linked to the regulation of the actin cytoskeleton.

Connexin43 confers Temozolomide resistance in human glioma cells by modulating the mitochondrial apoptosis pathway

“…Human LN229 glioma cells (ATCC, Manassas, VA, USA) were infected with retroviral pMSCVpuro vectors with either wild-type Cx43 (designated as Cx43), Cx43 truncated at amino acid 243 (TrCx43), or with an empty plasmid (Mock) as described previously (Crespin et al, 2010). The channel dead Cx43 mutant (T154A) (Beahm et al, 2006) was generated using a site directed mutagenesis kit (Qiagen) with the primer pair (forward: 5 0 GGCTTGCTGAGAGCCTACATCATCAGCATCC 3 0 ; reverse complement: 5 0 GGATGCTGATGATGTAGGCTCTCAGCAAGCC 3 0 ) and inserted into a pMSCV vector (Clontech).…”

The gap junction protein Cx43 is involved in the bone-targeted metastatic behaviour of human prostate cancer cells

“…PCa cells overexpressing Cx43 (PC-3 Cx43 or LNCaP Cx43) were prepared as previously described [29] by means of retroviral particles containing human Cx43. Control cells were obtained using an empty pMSCV-puro vector (PC-3 mock or LNCaP mock).…”

Internal Ribosomal Entry Site (IRES) Activity Generates Endogenous Carboxyl-terminal Domains of Cx43 and Is Responsive to Hypoxic Conditions

“…Cx43, besides conveying channel forming properties, has also been described as being involved in the regulation of additional biological functions, such as control of cell growth, cell survival, and differentiation (5,6); migration of neural precursor and glioma cells (7)(8)(9); and neuroprotection after hypoxic stress (10). An inverse relationship exists between Cx43 expression and cell growth (11,12), and a carboxyl-terminal domain was found to be as effective as full-length Cx43 in suppressing cell growth in a variety of cell lines (13)(14)(15).…”