The C57BL/6J Mouse Strain Background Modifies the Effect of a Mutation in Bcl2l2

Abstract

Bcl2l2 encodes BCL-W, an antiapoptotic member of the BCL-2 family of proteins. Intercross of Bcl2l2 +/− mice on a mixed C57BL/6J, 129S5 background produces Bcl2l2 −/− animals with the expected frequency. In contrast, intercross of Bcl2l2 +/− mice on a congenic C57BL/6J background produces relatively few live-born Bcl2l2 −/− animals. Genetic modifiers alter the effect of a mutation. C57BL/6J mice (Mus musculus) have a mutant allele of nicotinamide nucleotide transhydrogenase (Nnt) that can act as a modifier. Loss of NNT decreases the concentration of reduced nicotinamide adenine dinucleotide phosphate within the mitochondrial matrix. Nicotinamide adenine dinucleotide phosphate is a cofactor for glutathione reductase, which regenerates reduced glutathione, an important antioxidant. Thus, loss of NNT activity is associated with increased mitochondrial oxidative damage and cellular stress. To determine whether loss of Bcl2l2 −/− mice on the C57BL/6J background was mediated by the Nnt mutation, we outcrossed Bcl2l2 congenic C57BL/6J (Nnt −/−) mice with the closely related C57BL/6JEiJ (Nnt +/+) strain to produce Bcl2l2 +/− ; Nnt +/+ and Bcl2l2 +/− ; Nnt −/− animals. Intercross of Bcl2l2 +/− ; Nnt +/+ mice produced Bcl2l2 −/− with the expected frequency, whereas intercross of Bcl2l2 +/− ; Nnt −/− animals did not. This finding indicates the C57BL/6J strain background, and possibly the Nnt mutation, modifies the Bcl2l2 mutant phenotype. This and previous reports highlight the importance of knowing the genetic composition of mouse strains used in research studies as well as the accurate reporting of mouse strains in the scientific literature.

Paclitaxel Reduces Axonal Bclw to Initiate IP3R1-Dependent Axon Degeneration

“…bclw−/− mice were a generous gift from Grant MacGregor (University of California, Irvine, CA; (Ross et al, 1998). Genotyping for the wild-type bclw gene and/or lacZ gene were performed by Transnetyx using the Bclw targeting sequence GCTCTGAACCTCCCCATGACTTAAATCCGTTGCTCTTTCT-TGGCCCTGCCCAGTGCCTCTGAGCATTTCACCTATCTCAGGAGC and the lacZ sequence CGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAGTCAGGCCACG-G. bclw−/− mice were maintained on a C57BL/6JEiJ background (Navarro et al, 2012). …”

Nlrp12 mutation causes C57BL/6J strain-specific defect in neutrophil recruitment

“…Nlrp12 : forward primer (5′-CTGGGAGCTGGATTT-3′), reverse primer (5′-TATCCTGGTCGGCTTCATTC-3′); Crb1 : forward primer (5′- CGAGTGGACTTTGTGCTCACC-3′), reverse primer (5′- TTGACAATCCGAAAGGCCTGC-3′); Nnt common primer (5′-GTAGGGCCAACTGTTTCTGCATGA-3′), WT primer (5′-GGGCATAGGAAGCAAATACCAAGTTG-3′) and mutant primer (5′-GTGGAATTCCGCTGAGAGAACTCTT-3′)35. Once amplified SNP and indel differences were either identified by Sanger sequencing ( Nlrp12 and Crb1 ) or by running PCR products on a 1% agarose gel ( Nnt ).…”

C57BL/6 Substrains Exhibit Different Responses to Acute Carbon Tetrachloride Exposure: Implications for Work Involving Transgenic Mice

“…Bcl2l2 encodes for BCL-W, which protects cells from apoptosis during cellular and oxidative stress 52 . When Bcl2l2−/− mice are on an Nnt mutant (6J) background, they display increased embryonic lethality compared to Bcl2l2−/− on an Nnt wild-type (6N) background 31,52 . Similarly, mice deficient in mitochondrial superoxide dismutase ( Sod2−/− ) exhibit enhanced tissue damage and increased lethality shortly after birth when they are on an Nnt mutant background compared to Sod2−/− mice on an Nnt wild-type background 5 .…”

“…All mice were genotyped for Nnt status using DNA isolated from flash-frozen liver, using the Qiagen DNeasy Blood and Tissue Kit (Valencia, CA), and polymerase chain reaction (PCR) (Invitrogen PCR reagents) as previously described 31 . In brief, the reaction mixture contained final concentration of 1X PCR buffer, 2.5mM MgCl 2 , 0.67mM dNTPs, 1.25U Platinum Taq Polymerase, 1.0μM Nnt-Com (5’-GTAGGGCCAACTGTTTCTGCATGA-3’), 0.67μM Nnt-Mut (5’-GTGGAATTCCGCTGAGAGAACTCTT-3’), 0.33μM Nnt-wild-type (5’-GGGCATAGGAAGCAAATACCAAGTTG-3’), 2μL isolated DNA, and water to 25μL.…”