The brain-specific factor FEZ1 is a determinant of neuronal susceptibility to HIV-1 infection

Abstract

Neurons are one of the few cell types in the human body that do not support HIV type-1 (HIV-1) replication. Although the lack of key receptors is a major obstacle to infection, studies suggest that additional functions inhibit virus replication to explain the exquisite resistance of neurons to HIV-1. However, specific neuronal factors that may explain this resistance remain to be discovered. In a screen for antiviral factors using a fibroblast line chemically mutagenized and selected for resistance to retroviral infection, we recently identified induction of rat FEZ1 (fasciculation and elongation protein zeta-1), a brain-specific protein, as the cause of this resistance. When exogenously expressed in nonneuronal cell lines rat FEZ1 blocked nuclear entry of retroviral DNA. Here, we demonstrate that among human brain cells, neurons naturally express high levels of FEZ1 compared to astrocytes or microglia cells and are correspondingly less susceptible to infection with pseudotyped HIV-1 that bypasses receptor-mediated viral entry. Demonstrating that endogenous FEZ1 was functionally important in the resistance of neurons to HIV-1 infection, siRNA-mediated knockdown of endogenous FEZ1 increased the infectivity of neurons while sensitive brain cell types like microglia became more resistant upon FEZ1 overexpression. In addition, FEZ1 expression was not induced in response to IFN treatment. As such, in contrast to other widely expressed, IFN-inducible antiviral factors, FEZ1 appears to represent a unique neuron-specific determinant of cellular susceptibility to infection in a cell type that is naturally resistant to HIV-1.

PDZD8 Is a Novel Gag-Interacting Factor That Promotes Retroviral Infection

“…To test whether endogenous levels of PDZD8 also influenced cellular susceptibility to infection, different human cell lines were treated with two independent short interfering RNA (siRNA) duplexes toward human PDZD8 (Ambion) or a control duplex, and the consequences were assessed by infection with HIV-1-VSV-luc (16). In both CHME3 and 293A cells, PDZD8-specific RNAi duplexes significantly reduced expression of PDZD8, as confirmed by qPCR (Fig.…”

“…CHME3 cells stably overexpressing Flag-tagged PDZD8 or Flag alone were infected with HIV-1-VSV-luc and HIV-1-VSV-puro, HIV-based viral vectors pseudotyped with the VSV-G envelope protein carrying a luciferase reporter or a puromycin resistance marker, respectively (16). Overexpres-sion of PDZD8, as illustrated by two of the tested Flag-tagged PDZD8 clones, enhanced infection by either HIV-1-VSV-luc (Fig.…”

“…To determine the step in the viral life cycle at which PDZD8 functioned, viral DNA synthesis was examined after infection of PDZ-Flag-1.3 and Flag-1.2 lines with HIV-1-VSV-puro (16). Low-molecular-weight DNA was isolated 24 h postinfection (h.p.i.)…”

“…Cytoplasmic RNA was reverse transcribed and used as template for qPCR using SYBR green JumpStart Taq ReadyMix (Sigma) and PDZD8-specific primers: forward, 5ЈGCTTGCCTACAGAGGAAAGG; and reverse, 5ЈAAGCAGGCCAGAGTGCATAC. The number of human target copies in each sample was interpolated from its detection threshold (C T ) value using a human cyclophilin A (CypA) standard curve (16). Data are median copy numbers normalized to CypA obtained in triplicates from two independent RNA preparations.…”

Hepatitis B Versus Hepatitis C in Blood Donors

“…3 About a third of the world population has been infected at one point in their lives, 4 including 350 million who are chronic carriers. 5 The virus is transmitted by exposure to infectious blood or body fluids such as semen and vaginal fluids, while viral DNA has been detected in the saliva, tears, and urine of chronic carriers.…”