The baculovirus promoter OpIE2 sequence has inhibitory effect on the activity of the cytomegalovirus (CMV) promoter in HeLa and HEK-293 T cells

The Transgene Expression of the Immature Form of the HCV Core Protein (C191) and the LncRNA MEG3 Increases Apoptosis in HepG2 Cells

“…The pCI-MEG3 plasmid was obtained from Addgene (Addgene plasmid # 44727), and pCI-MEG3 lacking MEG3 (pCI∆MEG3) was performed by deleting the MEG3 gene from the pCI-MEG3 vector by restriction enzymes EcoR1-HF and Not1 (NEB, Ipswich, MA, USA). pCI∆MEG3 vector of ~3964 bp size was purified from gel using MinElute gel extraction kit (Qiagen, Hilden, Germany), and then the gap was filled using Phusion high fidelity Taq polymerase (NEB, Ipswich, MA, USA) [ 30 ]. The product was ligated by T4 ligase (NEB, Ipswich, MA, USA) and transformed into E.coli DH5α cells.…”

“…Before the insertion of C191 and C173 in the pEGFP-N1 vector, they subcloned in other vectors to facilitate their insertion in the pEGFP-N1 vector. The sequence corresponding to C191 was amplified by PCR using the primers 5′GCGAATTCAGCACGAATCCTAAACCT3′, and 5′TAGGTGGCCGAAGCGGGGACAAGT3′ and the following program; 95 °C for 30 s followed by 30 cycles of (95 °C for 30 s, 60 °C for 30 s, 72 °C for 2 min) and a final extension step at 72 °C for 5 min [ 30 ]. Then the PCR product was then cloned into a pDrive cloning vector by TA cloning using a PCR cloning kit (Qiagen, Hilden, Germany) before being transformed into competent E. coli DH5a.…”

“…The sequence corresponding to C173 was amplified by PCR using the following primers 5′GCGAATTCAGCACGAATCCTAAACCT3′, which contains EcoR1-HF restriction sequence in bold, and 5′TGCTCTAGATTAGGAGCAACCGGGGAGATT3′, which contains Xba1 restriction sequence in bold. In the following program; 95 °C for 30 s was followed by 30 cycles (95 °C for 30 s, 55 °C for 30 s, 72 °C for 2 min) and a final extension step at 72 °C for 5 min [ 30 ]. The PCR product was also digested with restriction endonucleases EcoR1-HF and Xba1 (NEB, Ipswich, MA, USA).…”

“…For co-transfection, 0.25 g DNA of each recombinant vector was used. Before adding the transfection complexes to the cells, they were prepared in an opti-mem reduced serum medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) before incubation at RT for 30 min [ 30 ]. The transfected cells were cultured for 48–72 h at 37 °C with 5% CO 2 .…”

Engineered Fungus Thermothelomyces thermophilus Producing Plant Storage Proteins

“…Only exchanging the terminators TtrpC for Ttef1 for a bidirectional histone-ge promoters system in Aspergillus resulted in a significant increase in the relative multige expression by a factor of 1.8, while they were interchangeable and equally efficient f many other expression constructs [48]. Moreover, the use of the similar promoters in simultaneously operating dual-promoter vector system was thought to interfere wi their effectiveness, because the promoter interference has the potential to occur betwe vector-borne promoters and endogenous promoters following vector integration [4 However, the 5′-end of OpIE2 insect viral promoter was found to be blocking the activi of the CMV promoter, constructed in a tandem arrangement, when transforming mam malian cells [49]. Evidently, the promoter interference cannot always be anticipated an empirical validation of functionality should be a prerequisite, as vector containing mo than one target gene and promoters and promoter design features can significantly im pact performance [40,44].…”