The Arabidopsis thaliana non-specific phospholipase C2 is involved in the response to Pseudomonas syringae attack

Krčková, Zuzana; Kocourková, Daniela; Daněk, Michal; Brouzdová, Jitka; Pejchar, Přemysl; Janda, Martin; Pokotylo, Igor; Ott, Péter G.; Valentová, Olga; Martinec, Jan

doi:10.1093/aob/mcx160

Cited by 27 publications

(24 citation statements)

References 78 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At PIP2;1–GFP (Boursiac et al , ), At VAMP711–GFP (Geldner et al , ), At Lti6b–GFP (Grebe et al , ) and FABD:GFP/mCherry:TUA5 (Sampathkumar et al , ) lines were obtained from Doan‐Trung Luu, Markus Grebe, Niko Geldner and Staffan Persson respectively. At FLOT1 (At5g25250), At FLOT2 (At5g25260), At FLOT3 (At5g64870), At HIR1 (At1g69840) and At IQD6 (At2g26180) coding sequences were amplified from A. thaliana cDNA prepared as described elsewhere (Krckova et al , ) using PCR with specific primers ( At FLOT1 FP: CGCGGATCCATGTTCAAAGTTGCAAGAGCG; At FLOT1 RP: CGGAATTCGCTGCGAGTCACTTGC; At FLOT2 FP: TTAGGATCCATGTTCAAGGTTGCAAGAG; At FLOT2 RP: TTAGAATTCCTTGCTTAGAGTACCGATCC; At FLOT3 FP: TTAGGATCCATGAGTTACAGAGTCGCTAAAGCA; At FLOT3 RP: TTAGAATTCACCTCTGTGTTGTTGAGCATG; At HIR1 FP: TTAGGATCCATGGGTCAAGCTTTGGGTTG; At HIR1 RP: TTAGAATTCCTCAGCA GCAGAGTTACCCTG; At IQD6 FP: GCGGGATCCATGGGTGCTTCAGGGAAATG and At IQD6 RP: CCGAATTCACCTCTCGGCTTCTCGAATC). Obtained amplicons were digested using Eco RI and Bam HI (both Thermo Fisher Scientific, Waltham, MA, USA) and in frame directly introduced in between corresponding restriction sites of modified pGreen0029 plasmid (Hellens et al , ) containing CaMV 35S promoter and C‐terminal mCherry ( At IQD6) or eGFP sequence (the rest of amplicons).…”

Section: Methodsmentioning

confidence: 99%

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

et al. 2019

Self Cite

View full text Add to dashboard Cite

Current models of plasma membrane (PM) postulate its organization in various nano-and micro-domains with distinct protein and lipid composition. While metazoan PM nanodomains usually display high lateral mobility, the dynamics of plant nanodomains is often highly spatially restricted. Here we have focused on the determination of the PM distribution in nanodomains for Arabidopsis thaliana flotillin (AtFLOT) and hypersensitive induced reaction proteins (AtHIR), previously shown to be involved in response to extracellular stimuli. Using in vivo laser scanning and spinning disc confocal microscopy in Arabidopsis thaliana we present here their nanodomain localization in various epidermal cell types. Fluorescence recovery after photobleaching (FRAP) and kymographic analysis revealed that PM-associated AtFLOTs contain significantly higher immobile fraction than AtHIRs. In addition, much lower immobile fractions have been found in tonoplast pool of AtHIR3. Although members of both groups of proteins were spatially restricted in their PM distribution by corrals co-aligning with microtubules (MTs), pharmacological treatments showed no or very low role of actin and microtubular cytoskeleton for clustering of AtFLOT and AtHIR into nanodomains. Finally, pharmacological alteration of cell wall (CW) synthesis and structure resulted in changes in lateral mobility of AtFLOT2 and AtHIR1. Accordingly, partial enzymatic CW removal increased the overall dynamics as well as individual nanodomain mobility of these two proteins. Such structural links to CW could play an important role in their correct positioning during PM communication with extracellular environment.

show abstract

Section: Methodsmentioning

confidence: 99%

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…The reaction was initiated by adding protein solution, and incubated at 28 C with 300 rpm for 30 min. Lipids were extracted and run through high-performance thin-layer chromatography (HP-TLC) silica gel-60 plates as in Krckova et al (2018). Plates were developed in a mobile phase of acetone/ethanol (1/1, by vol) and laser-scanned using a Fuji FLA-7000 fluorescence scanner.…”

Section: Determination Of Pldα Activity In Protein Soluble Fractionsmentioning

confidence: 99%

Phospholipase Dα1 mediates the high‐Mg²⁺ stress response partially through regulation of K⁺ homeostasis

Kocourková

Krčková

Pejchar

et al. 2020

Plant Cell & Environment

Self Cite

View full text Add to dashboard Cite

Intracellular levels of Mg2+ are tightly regulated, as Mg2+ deficiency or excess affects normal plant growth and development. In Arabidopsis, we determined that phospholipase Dα1 (PLDα1) is involved in the stress response to high‐magnesium conditions. The T‐DNA insertion mutant pldα1 is hypersensitive to increased concentrations of magnesium, exhibiting reduced primary root length and fresh weight. PLDα1 activity increases rapidly after high‐Mg2+ treatment, and this increase was found to be dose dependent. Two lines harbouring mutations in the HKD motif, which is essential for PLDα1 activity, displayed the same high‐Mg2+ hypersensitivity of pldα1 plants. Moreover, we show that high concentrations of Mg2+ disrupt K+ homeostasis, and that transcription of K+ homeostasis‐related genes CIPK9 and HAK5 is impaired in pldα1. Additionally, we found that the akt1, hak5 double mutant is hypersensitive to high‐Mg2+. We conclude that in Arabidopsis, the enzyme activity of PLDα1 is vital in the response to high‐Mg2+ conditions, and that PLDα1 mediates this response partially through regulation of K+ homeostasis.

show abstract

“…In Gram‐positive bacteria, NPC orthologues were identified as potent toxins related to Clostridium perfringens alpha‐toxin (Titball, ; Pokotylo et al ., ). In Arabidopsis, six isoforms of NPC are known (Nakamura et al ., ) and were found to be involved in the stress response under phosphate deficiency (NPC4 and NPC5: Nakamura et al ., ; Gaude et al ., ), salinity (NPC4 and NPC5: Peters et al ., , ; Kocourková et al ., ), heat shock (NPC1: Krčková et al ., ), and immunity (NPC2: Krčková et al ., ). Recently, we showed that NPC2 and NPC6 redundantly play an essential role in gametogenesis because double‐knock‐out mutants showed a gametophytic‐lethal phenotype (Ngo et al ., ).…”

Section: Introductionmentioning

confidence: 97%

Non‐specific phospholipases C, NPC2 and NPC6, are required for root growth in Arabidopsis

2019

View full text Add to dashboard Cite

Summary Mutants in lipid metabolism often show a lethal phenotype during reproduction that prevents investigating a specific role of the lipid during different developmental processes. We focused on two non‐specific phospholipases C, NPC2 and NPC6, whose double knock‐out causes a gametophyte‐lethal phenotype. To investigate the role of NPC2 and NPC6 during vegetative growth, we produced transgenic knock‐down mutant lines that circumvent the lethal effect during gametogenesis. Despite no defect observed in leaves, root growth was significantly retarded, with abnormal cellular architecture in root columella cells. Furthermore, the short root phenotype was rescued by exogenous supplementation of phosphocholine, a product of non‐specific phospholipase C (NPC) ‐catalyzed phosphatidylcholine hydrolysis. The expression of phospho‐base N‐methyltransferase 1 (PMT1), which produces phosphocholine and is required for root growth, was induced in the knock‐down mutant lines and was attenuated after phosphocholine supplementation. These results suggest that NPC2 and NPC6 may be involved in root growth by producing phosphocholine via metabolic interaction with a PMT‐catalyzed pathway, which highlights a tissue‐specific role of NPC enzymes in vegetative growth beyond the gametophyte‐lethal phenotype.

show abstract

The Arabidopsis thaliana non-specific phospholipase C2 is involved in the response to Pseudomonas syringae attack

Abstract: This first experimental characterization of NPC2 provides new insights into the role of the non-specific phospholipase C protein family. The results suggest that NPC2 is involved in the response of Arabidopsis to P. syringae attack.

Cited by 27 publications

References 78 publications

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

Phospholipase Dα1 mediates the high‐Mg²⁺ stress response partially through regulation of K⁺ homeostasis

Non‐specific phospholipases C, NPC2 and NPC6, are required for root growth in Arabidopsis

Contact Info

Product

Resources

About

The Arabidopsis thaliana non-specific phospholipase C2 is involved in the response to Pseudomonas syringae attack

Abstract: This first experimental characterization of NPC2 provides new insights into the role of the non-specific phospholipase C protein family. The results suggest that NPC2 is involved in the response of Arabidopsis to P. syringae attack.

Cited by 27 publications

References 78 publications

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

Cell wall contributes to the stability of plasma membrane nanodomain organization of Arabidopsis thaliana FLOTILLIN2 and HYPERSENSITIVE INDUCED REACTION1 proteins

Phospholipase Dα1 mediates the high‐Mg2+ stress response partially through regulation of K+ homeostasis

Non‐specific phospholipases C, NPC2 and NPC6, are required for root growth in Arabidopsis

Contact Info

Product

Resources

About

Phospholipase Dα1 mediates the high‐Mg²⁺ stress response partially through regulation of K⁺ homeostasis