The ameliorative effect of nanoselenium on histopathological and biochemical alterations induced by melamine toxicity on the brain of adult male albino rats

Bashir, Dina W; Rashad, Maha M.; Ahmed, Yasmine H.; Drweesh, Elsayed A.; Elzahany, Eman A.M.; Abou‐El‐Sherbini, Khaled S.; Elleithy, Ebtihal M.M.

doi:10.1016/j.neuro.2021.06.006

Cited by 25 publications

(10 citation statements)

References 76 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our ndings are consistent with other studies, in which it was indicated that SeNP attenuated oxidative stress in diabetic rats (Dkhil et al, 2016), reversed memory impairment, and induced neuroprotection effect in epileptic mice (Yuan et al, 2020). The coated SeNP similar to nano selenium ameliorated toxic effect on the brain of rats through antioxidant capacity (Bashir et al, 2021) and also up-regulated the BDNF levels in the hippocampus. Our results showed that treatment with PVA-coated SeNPs reduced the deposition of Aβ in the hippocampus in AD rats.…”

Section: Discussionsupporting

confidence: 92%

Effect of co-treatment with mesenchymal stem cells and polyvinyl alcohol- coated selenium nanoparticles on rats with streptozotocin-induced Alzheimer's disease

Shahidi

Asl

Gholamigeravand

et al. 2022

Preprint

View full text Add to dashboard Cite

Mesenchymal stem cell (MSC) transplantation is a potential strategy for the treatment of Alzheimer’s disease (AD). The stem cells have a short lifespan after transplantation in the recipient animals. Selenium nanoparticles facilitate drug treatment in brain diseases due to their size. The aim of this study was to investigate the possible therapeutic effect of co-treatment of MSCs with polyvinyl alcohol (PVA)-coated selenium nanoparticles (SeNPs) against streptozotocin (STZ)-mediated AD in rats. Rats were assigned to five groups: control, Alz (STZ; 3 mg/kg, 10 μL, ICV), Alz+stem cell (ICV transplantation), Alz+SeNP (0.4 mg/kg, orally), and Alz+stem cell+SeNPs. ICV administration of STZ mimicked some aspects of AD in Alz groups. SeNPs were administrated for 30 days after STZ administration. The novel object recognition (NOR) and passive avoidance learning (PAL) tests were used to measure cognition and memory. Oxidative stress biomarkers, brain-derived neurotrophic factor (BDNF), and amyloid-beta plaques were assessed by biochemical analysis, ELISA kit, and Congo red staining, respectively. The combined treatment of PVA-coated SeNPs and MSCs transplantation was more effective in increasing the memory reacquisition than the administration of SeNPs or MSCs alone. The stem cells and PVA-coated SeNPs together significantly increased the antioxidant capacity and reduced the amyloid-beta plaques. It seems that co-treatment with PVA-coated SeNP with MSCs has a great neuroprotection effect against AD in animal models.

show abstract

Section: Discussionsupporting

confidence: 92%

Effect of co-treatment with mesenchymal stem cells and polyvinyl alcohol- coated selenium nanoparticles on rats with streptozotocin-induced Alzheimer's disease

Shahidi

Asl

Gholamigeravand

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…Therefore, any disruption in albumin levels could potentially lead to neuronal injury. 49 Furthermore, records of this study show some hippocampal pyramidal layer neurons suffering from karyolitic nuclei, which might be attributed to nuclear envelope disruption as previously discussed by Bashir et al 50 Regarding the cerebellar Purkinje cells, affections in this study were manifested as disruption of their linear arrangement as well as loss of their familiar flask-shaped appearance (distortion). The same observations were previously mentioned by Mowafy et al 18 who administered 24 adult male albino rats CuO-NPs intraperitoneally at a dose of 0.5 mg/kg for 14 days.…”

Section: Hippocampus (Ca3)supporting

confidence: 72%

“…107 Three biological replicates were used for each qRT-PCR analysis, and each biological replicate was evaluated three times. 50 Template-free negative controls were included in each experiment. 108 The relative transcription levels were determined by employing the comparative 2 −ΔΔCT technique.…”

Section: Ir Itl Rtl/rtl =mentioning

confidence: 99%

Neuroprotective Assessment of Betaine against Copper Oxide Nanoparticle-Induced Neurotoxicity in the Brains of Albino Rats: A Histopathological, Neurochemical, and Molecular Investigation

Hashim,

Bashir,

Rashad

et al. 2024

ACS Chem. Neurosci.

Self Cite

View full text Add to dashboard Cite

Copper oxide nanoparticles (CuO-NPs) are commonly used metal oxides. Betaine possesses antioxidant and neuroprotective activities. The current study aimed to investigate the neurotoxic effect of CuO-NPs on rats and the capability of betaine to mitigate neurotoxicity. Forty rats; 4 groups: group I a control, group II intraperitoneally CuO-NPs (0.5 mg/kg/day), group III orally betaine (250 mg/kg/day) and CuO-NPs, group IV orally betaine for 28 days. Rats were subjected to neurobehavioral assessments. Brain samples were processed for biochemical, molecular, histopathological, and immunohistochemical analyses. Behavioral performance of betaine demonstrated increasing locomotion and cognitive abilities. Group II exhibited significantly elevated malondialdehyde (MDA), overexpression of interleukin-1 beta (IL-1β), and tumor necrosis factor-alpha (TNF-α). Significant decrease in glutathione (GSH), and downregulation of acetylcholine esterase (AChE), nuclear factor erythroid 2-like protein 2 (Nrf-2), and superoxide dismutase (SOD). Histopathological alterations; neuronal degeneration, pericellular spaces, and neuropillar vacuolation. Immunohistochemically, an intense immunoreactivity is observed against IL-1β and glial fibrillary acidic protein (GFAP). Betaine partially neuroprotected against CuO-NPs associated alterations. A significant decrease at MDA, downregulation of IL-1β, and TNF-α, a significant increase at GSH, and upregulation of AChE, Nrf-2, and SOD. Histopathological alterations partially ameliorated. Immunohistochemical intensity of IL-1β and GFAP reduced. It is concluded that betaine neuroprotected against most of CuO-NP neurotoxic effects through antioxidant and cell redox system stimulating efficacy.

show abstract

“…Subsequently, 2 µg of isolated total RNA was reverse‐transcribed into complementary DNA. The primer pairs of Bax forward: ACCAAGCTGAGCGAGG, reverse: CCAGTTGAAGTTGCCGTCTG, [ 37 ] Cytc forward: TACCCTCTCAACGACAGCAG, reverse: TCTTGACATTCTCCTCGGTG, [ 38 ] and NRF2 gene sense primer: 5′‐GGCCCTCAATAGTGCTCAG‐3′; antisense primer: 5′‐TAGGCACCTGTGGCAGATTC‐3′ [ 39 ] were used for qRT‐PCR analysis. SYBR Green PCR Master Mix was used for RT‐PCR analysis.…”

Section: Methodsmentioning

confidence: 99%

Ameliorative effect of N‐acetylcysteine on the testicular tissue of adult male albino rats after glyphosate‐based herbicide exposure

Hashim

Bashir

Yasin

et al. 2022

J Biochem & Molecular Tox

Self Cite

View full text Add to dashboard Cite

Glyphosate (GLP) is a broad-spectrum herbicide that is frequently used in crop production, but its residues remain in foodstuffs. This, in turn, has led to potential adverse effects on both human and animal health. Recent studies emphasized that GLP induces teratogenic effects and reproductive disorders, but its mechanism of toxicity is highly debated. N-acetylcysteine (NAC) is well known for its potent antioxidant capacity in addition to anti-inflammatory and cytoprotective properties.Therefore, our study aimed to investigate the reproductive toxicity of GLP in mature rats and evaluate the possible ameliorative effect of NAC against this toxicity. To this end, 30 adult male rats were assigned into three groups (10 rats per group) as follows: Group I, negative control; group II, GLP-exposed; 375 mg/kg GLP, orally; group III, NAC-cotreated, 160 mg/kg NAC 1 h before GLP, plus GLP, 375 mg/kg orally for 6 weeks. At the end of the experiment, the testicles were collected for semen analysis and biochemical, histopathological, and immunohistochemical studies. GLP-exposed rats exhibited disturbances in seminal parameters and a significant increase in malondialdehyde levels and expression of apoptotic markers. Several histopathological changes were observed, including strong immunoreactions for caspase-3 and proliferating cell nuclear antigen. Conversely, the administration of NAC before GLP was able to improve seminal parameters, attenuate the induced oxidative stress and apoptosis in addition to the regeneration of testicular damage.In conclusion, NAC can ameliorate the reproductive toxicity induced by GLP to an acceptable degree.

show abstract

The ameliorative effect of nanoselenium on histopathological and biochemical alterations induced by melamine toxicity on the brain of adult male albino rats

Cited by 25 publications

References 76 publications

Effect of co-treatment with mesenchymal stem cells and polyvinyl alcohol- coated selenium nanoparticles on rats with streptozotocin-induced Alzheimer's disease

Effect of co-treatment with mesenchymal stem cells and polyvinyl alcohol- coated selenium nanoparticles on rats with streptozotocin-induced Alzheimer's disease

Neuroprotective Assessment of Betaine against Copper Oxide Nanoparticle-Induced Neurotoxicity in the Brains of Albino Rats: A Histopathological, Neurochemical, and Molecular Investigation

Ameliorative effect of N‐acetylcysteine on the testicular tissue of adult male albino rats after glyphosate‐based herbicide exposure

Contact Info

Product

Resources

About