Th1 Predominance and Perforin Expression in Minor Salivary Glands from Patients with Primary Sjögren's Syndrome

Kolkowski, E.; Reth, Peter; Pelusa, Fabián; Bosch, J.; Pujol-Borrell, Ricardo; Coll, J; Jaraquemada, Dolores

doi:10.1006/jaut.1999.0289

Cited by 66 publications

(62 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Salivary gland CD4 ϩ T cells from SS patients express IL-2 and IFN-␥ (26), and studies of salivary glands in SS patients also confirmed the expression of Th1-related cytokines (IL-2, IFN-␥, IL-12, and IL-18) by RT-PCR (27), indicating that SS is a Th1-related disease (1). In addition, salivary gland CD4 ϩ T cells express IL-10 and salivary gland epithelial cells express IL-6 in SS patients (26), and other studies showed that salivary glands consistently express IL-10, IL-6, and TGF-␤ (27,28). Consistent with this observation, overexpression of IL-10 in salivary glands using a human salivary amylase promoter in mice develop SS-like symptoms (29).…”

Section: Discussionmentioning

confidence: 96%

“…In addition, IL-6 inhibits the differentiation and function of regulatory T cells, and IL-6 with TGF-␤ promotes the development of Th17 cells (16,17). Salivary gland epithelial cells of SS patients express IL-6 (26), and other studies showed that salivary glands consistently express IL-10, IL-6, and TGF-␤ (27,28). IL-8 is a major chemokine that is responsible for the activation of neutrophils and the migration of neutrophils and T cells to the inflammatory sites (46).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Identification of IL-18 and Th17 Cells in Salivary Glands of Patients with Sjögren’s Syndrome, and Amplification of IL-17-Mediated Secretion of Inflammatory Cytokines from Salivary Gland Cells by IL-18

Sakai

Sugawara

Kuroishi³

et al. 2008

The Journal of Immunology

242

181

View full text Add to dashboard Cite

IL-18 is a proinflammatory cytokine and plays an important pathogenic role in inflammatory and autoimmune disorders. IL-17 is also a proinflammatory cytokine and IL-17-secreting Th17 cells are involved in autoimmunity. However, the pathological roles of IL-18 and Th17 cells in Sjögren’s syndrome (SS) remain to be elucidated. This study showed that the expression of IL-18 was detected in acinar cells, intraducts, and CD68+ macrophages in salivary glands of SS patients, but not in those of healthy subjects or patients with chronic graft-vs-host disease, by immunohistochemistry, and immunoblot analysis revealed that 24-kDa precursor form of IL-18 (proIL-18) and 18-kDa mature IL-18 were detected in SS salivary glands. The majority of the infiltrating cells in the salivary glands of SS patients were CD4+ T cells, and CD8+ T cells were infiltrated to a lesser extent. The predominant expression of IL-17 was found in infiltrating CD4+ T cells, whereas a small number of infiltrating CD8+ T cells expressed IL-17. Human salivary gland HSY and acinar AZA3 cells constitutively expressed proIL-18 and caspase-1, and a calcium ionophore A23187 induced the secretion of IL-18 from the cells. HSY and AZA3 cells expressed IL-18R and IL-17R on the cell surface, and IL-18 amplified the secretion of IL-6 and IL-8 that were induced by low amounts of IL-17. Primary salivary gland cells from normal subjects partially confirmed these findings. These results suggest that IL-18 and Th17 cells detected in the salivary glands in SS patients are associated with the pathogenesis of SS in the salivary glands.

show abstract

Section: Discussionmentioning

confidence: 96%

Section: Discussionmentioning

confidence: 99%

Identification of IL-18 and Th17 Cells in Salivary Glands of Patients with Sjögren’s Syndrome, and Amplification of IL-17-Mediated Secretion of Inflammatory Cytokines from Salivary Gland Cells by IL-18

Sakai

Sugawara

Kuroishi³

et al. 2008

The Journal of Immunology

242

181

View full text Add to dashboard Cite

show abstract

“…Several investigators have suggested that polarized Th1 balance is associated with the pathogenesis of SS (35)(36)(37). IFN␥ induces expression of HLA-DR and costimulatory molecules such as CD40 and B7 on salivary epithelial cells, resulting in the promotion of autoimmune reactions between epithelial cells and lymphocytes (38)(39)(40).…”

Section: Discussionmentioning

confidence: 99%

Antagonist of interferon‐inducible protein 10/CXCL10 ameliorates the progression of autoimmune sialadenitis in MRL/lpr mice

Hasegawa¹,

Inoue²,

Kohno³

et al. 2006

Arthritis & Rheumatism

View full text Add to dashboard Cite

Objective. Mononuclear cell infiltration of the salivary glands is a major feature of Sjögren's syndrome (SS) and its animal model. Local generation of chemokines and the presence of chemokine receptors on the infiltrating cells may be involved in this process. We undertook the present study to investigate the expression of chemokines during the development of autoimmune sialadenitis in MRL/lpr mice and the therapeutic effect of chemokine antagonists on sialadenitis.Methods. NH 2 -terminal-truncated interferoninducible protein 10 (IP-10)/CXCL10 analogs were transfected into a nonmetastatic fibroblastoid cell line, MRL/N-1, and injected subcutaneously into MRL/lpr mice, and the effects on sialadenitis were monitored.Results. IP-10 analogs truncated by 5 or more amino acid residues from the N-terminal failed to induce chemotaxis and calcium influx by CXCR3-expressing cells. Of these, the most potent antagonist (AT) (IP-10-AT) was a molecule with methionine added after removal of the 5 N-terminal amino acid residues. Significantly increased expression of the Th1-associated chemokines IP-10, monokine induced by interferon-␥/ CXCL9, and interferon-inducible T cell chemoattractant/CXCL11 was induced in the ductal epithelium by interferon-␥ produced in the salivary glands, whereas expression of the Th2-associated chemokines thymus and activation-regulated chemokine (TARC)/ CCL17 and monocyte-derived chemokine/CCL22 was almost undetectable during sialadenitis. Inoculation of IP-10-AT into MRL/lpr mice during the early stage of sialadenitis significantly reduced periductal mononuclear cell infiltration and parenchymal destruction compared with these features in control and TARC-ATbearing mice. This was due to a significant reduction in infiltration of CXCR3؉ T cells, predominantly Th1 cells, resulting in decreased interferon-␥ production.Conclusion. We prepared a novel potent IP-10 antagonist and demonstrated its ability to ameliorate the progression of autoimmune sialadenitis. This agent may provide a new therapeutic approach to SS.

show abstract

“…Total RNA (1 g from each sample) was reversely transcribed using the ImProm-II Reverse Transcription System (Promega, Madison, WI) following the manufacturer's instructions. The following granulysin-, perforin-, or GAPDH-specific primers were used: 5Ј GGCCGTGACTACAGGACCTGTC 3Ј and 5Ј CCTGAGGTCCTCACA-GATCTG 3Ј 52 ; 5Ј ATGTAACCAGGGCCAAAGTCA 3Ј and 5Ј AGTGAT-GGCATGGACTGTGG 3Ј 53 ; and 5Ј TCACCATCTTCCAGGAGCGA 3Ј and 5Ј-AGTGATGGCATGGACTGTGG-3Ј. The PCR profile for granulysin, perforin, and GAPDH was as follows: denaturing at 94°C for 1 minute, followed by 25 cycles of denaturing at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds.…”

Section: Semiquantitative Reverse-transcription-polymerase Chain Reacmentioning

confidence: 99%

Cytotoxic CD4+ T cells use granulysin to kill Cryptococcus neoformans, and activation of this pathway is defective in HIV patients

Zheng

Ling²,

Jones

et al. 2006

Blood

View full text Add to dashboard Cite

IntroductionCD4 ϩ T cells function as both regulators and effectors in the immune response. 1 CD4 ϩ T cells produce cytokines, providing help in the immune response to pathogens, and have often been referred to as Th cells. 2 However, over the past 2 decades, the ability of CD4 ϩ T cells to become cytotoxic has been reported in both mice and humans against alloantigens, microbe-infected cells, and cancer. 1,[3][4][5][6][7][8] Previous studies in mice demonstrate that CD4 ϩ cytotoxic T lymphocytes (CTLs) cause target cell lysis primarily via Fas/FasL interactions. [9][10][11][12] Later, studies on human CD4 ϩ T cells demonstrated that CD4 ϩ CTLs also use perforin and granzymebased granule exocytosis. [13][14][15] This pathway involves disruption of the target cell membrane through extracellular Ca 2ϩ -dependent polymerization of perforin, accompanied by uptake of granzymes, which are responsible for downstream activation of caspases and subsequent DNA fragmentation, resulting in target cell apoptosis.Although the importance of CTL-mediated killing of tumor or microbe-infected cells is well established, direct CTL-mediated microbial killing has been underinvestigated. Evidence has suggested that CTLs have very potent direct antimicrobial activity. This activity requires cell contact and involves regulated exocytosis of granules from the cytoplasm of the effector cells. 16 Perforin and granzymes are well-known cytolytic molecules 17 ; however, granulysin is less well recognized. 16,18 The human granulysin cDNA was originally isolated by subtractive hybridization in a search for T-cell-specific molecules expressed "late" (3-5 days) after activation. 19 Granulysin, a member of the saposin-like protein family of lipid binding proteins, colocalizes with perforin and granzymes in the cytolytic granules of human CTLs and natural killer (NK) cells. [20][21][22] Two major protein products of granulysin, 15 and 9 kDa, are detected in CTL and NK cells. 22 It is apparent that the 9-kDa form is processed from the larger, precursor 15-kDa form, 22 and recombinant 9-kDa granulysin disrupts artificial liposomes and cell membranes, damages mitochondria, and activates caspase 9 to induce apoptosis. 23,24 Additionally, granulysin exhibits potent cytotoxic activity against a broad panel of microbial pathogens and tumor cells. 18,20 Our previous observation, using Cryptococcus neoformans, one of the most important microbial pathogens in patients with compromised CD4 ϩ T-cell-dependent immunity, such as the acquired immunodeficiency syndrome (AIDS), [25][26][27] indicated that granulysin is required for the CD8 ϩ T-cell-mediated direct antifungal activity. 28 By contrast, NK cells use perforin, rather than granulysin, as the effector molecule to kill C neoformans. 29 Although CD4 ϩ and CD8 ϩ T cells and NK cells are important in cryptococcal host defense, 30-32 defective CD4 ϩ T cells are clearly the major risk factor for disease in human immunodeficiency virus (HIV)-infected patients. 33 Previous studies have demonstrated that IL-2-ac...

show abstract

Th1 Predominance and Perforin Expression in Minor Salivary Glands from Patients with Primary Sjögren's Syndrome

Cited by 66 publications

References 41 publications

Identification of IL-18 and Th17 Cells in Salivary Glands of Patients with Sjögren’s Syndrome, and Amplification of IL-17-Mediated Secretion of Inflammatory Cytokines from Salivary Gland Cells by IL-18

Identification of IL-18 and Th17 Cells in Salivary Glands of Patients with Sjögren’s Syndrome, and Amplification of IL-17-Mediated Secretion of Inflammatory Cytokines from Salivary Gland Cells by IL-18

Antagonist of interferon‐inducible protein 10/CXCL10 ameliorates the progression of autoimmune sialadenitis in MRL/lpr mice

Cytotoxic CD4+ T cells use granulysin to kill Cryptococcus neoformans, and activation of this pathway is defective in HIV patients

Contact Info

Product

Resources

About