Tetrandrine Citrate Suppresses Breast Cancer via Depletion of Glutathione Peroxidase 4 and Activation of Nuclear Receptor Coactivator 4-Mediated Ferritinophagy

Abstract

Tetrandrine citrate (TetC), a novel tetrandrine salt with high water solubility, demonstrates a potent antitumor activity in chronic myeloid leukemia. Studies have indicated an important role of ferroptosis in breast cancer (BC). However, whether TetC inhibits BC progression via ferroptosis has never been explored. In the present study, we showed that TetC had a significant inhibitory effect on the proliferation and migration of MCF7 and MDA-MB-231 cells. Then, we combined TetC with different inhibitors to determine which form of cell death could be driven by TetC. MTT assay showed that ferrostatin (Fer-1) demonstrated the most potent effect on improving TetC-induced cell death in contrast to other inhibitors. TetC was also shown to significantly increase the mRNA level of prostaglandin-endoperoxide synthase 2 (Ptgs2), a ferroptosis marker. Further studies showed that TetC significantly suppressed the expression of glutathione peroxidase 4 (GPX4) and ferritin heavy chain 1 (FTH1) but increased the expression of nuclear receptor coactivator 4 (NCOA4) in MCF7 and MDA-MB-231 cells even in the presence of erastin or Ras-selective lethal 3 (RSL3). Collectively, we showed novel data that ferroptosis was a major form of TetC-induced cell death. Moreover, TetC-induced ferroptotic cell death was achieved via suppressing GPX4 expression and activating NCOA4-mediated ferritinophagy in BC cells.

Identification of a chromatin regulator signature in prognosis and immune infiltration in breast cancer

“…Mortality factor 4 like 1 (MORF4L1) is a part of NuA4 histone acetyltransferase (HAT) complex [31][32][33][34] and as a new BRCA complex-interacting protein, previous studies also identi ed its role in repairing DNA double-strand breaks in BC, revealing its protective role in BC initiation and progression [35][36][37][38]. Nuclear receptor coactivator 4 (NCOA4) is normally known as its function in mediating ferritinophagy [39,40] and recent research also shows its potential function in immune arousal of BC [41]. Moreover, the presence of NCOA4-rearranged during transfection (RET), one of the initial detections with oncogenic RET gene fusions, is proved to result in relative resistance to treatment with trastuzumab and pertuzumab in BC with ER+/ERBB2 ampli cation positive for NCOA4-RET fusion [42,43].…”

Citric acid promotes SPARC release in pancreatic cancer cells and inhibits the progression of pancreatic tumors in mice on a high‐fat diet

“…The shRNA sequence for RELA was GCCTTAATAGTAGGGTAAGTT, and the shRNA sequence for SPARC was CCTAGACAACGACAAGTACAT. A citrate concentration of 10 mmol·L −1 was selected for our in vitro experiments and 30 mg·kg −1 ·day −1 for the in vivo experiments, consistent with previous studies [42,43].…”

System Xc−/GSH/GPX4 axis: An important antioxidant system for the ferroptosis in drug-resistant solid tumor therapy

“…Furthermore, one study found that Ketamine inhibit the expression of GPX4 by attenuating KAT5 on the promoter region of GPX4, repressing the enrichment of histone H3 lysine 27 acetylation and RNA polymerase II ( Li H. et al, 2021 ). Some other small molecule compounds ( Table 2 ) such as alloimperatorin ( Zhang J. et al, 2022b ), tetrandrine citrate ( Yin et al, 2022 ), pyrrolidin-3,2′-oxindoles ( Liu S.-J. et al, 2021 ), Saponin Formosanin C ( Chen H.-C. et al, 2022 ) can also induce ferroptosis in breast cancer cells by interfering with the System X c − /GSH/GPX4 axis.…”