Telomere length at diagnosis of chronic phase chronic myeloid leukemia (CML-CP) identifies a subgroup with favourable prognostic parameters and molecular response according to the ELN criteria after 12 months of treatment with nilotinib

Abstract

The telomere complex consists of repetitive DNA sequences and associated proteins and is located at the end of eukaryotic chromosomes. Telomeres shorten with every cell division and thereby both reflect and restrict the proliferative capacity of somatic cells. Critically short telomeres are associated with genetic instability and eventually, replicative senescence. In chronic myeloid leukemia (CML), increased cellular turnover of clonal breakpoint cluster region-Abelson Murine Leukemia Viral Oncogene Homolog 1 (BCR-ABL)-positive hematopoietic stem and progenitor cells leads to significantly shortened telomeres in peripheral blood myeloid cells. 1 Accelerated telomere shortening was found to correlate with disease stage, cytogenetic remission status, progression to accelerated phase and blast crisis as well as clinical risk score at diagnosis in retrospective trials (refs 1-3, reviewed in ref. 4). However, whether telomere length (TL) can be used as prognostic indicator and/or to predict for depth and kinetics of response to tyrosine kinase inhibitor therapy in patients with CML has not been studied prospectively to date. Consequently, the aim of this substudy within the ENEST1st trial (NCT01061177) was to investigate, whether average TL in peripheral blood leukocytes at diagnosis measured by monochrome multiplex quantitative PCR (MM-qPCR) can be used as an independent prognostic and/or predictive biomarker in patients with CML undergoing first-line treatment with nilotinib. TL from 96 newly diagnosed CML patients before treatment initiation within the ENEST1st trial was measured using MM-qPCR and results were expressed as the standardized T/S ratio. 5 One extreme outlier was excluded from the analysis. Age adaption of TL, indicated as ΔT/S ratio, was performed using data from 89 healthy controls, representing blood donors. 6 The average intra-assay variability expressed as CV Intra-assay for all samples (n = 184; control and CML samples included) was 10.5%. In addition, to monitor plate-to-plate variation, eight reference blood samples from healthy volunteers (age range 24-83 years) were included in each run. The resulting average CV Inter-assay for all eight reference samples was 15.3%. Characteristics of healthy controls and patients are shown in Supplementary Material. The 89 control individuals (unfilled circles, Figure 1a) showed the expected decline in TL with increasing age-a characteristic no longer detectable in CML patients (filled circles). Mean age adjusted TL (ΔT/S ratio) of CML patients was more spread within different age groups and significantly shorter (ΔT/S: − 0.3097 ± 0.6644, n = 95, Po0.001). This is in line with previous studies suggesting accelerated telomere shortening in CML mostly due to an increased turnover of the leukemic as opposed to the coexisting normal stem cell compartment (ref. 1, reviewed in ref. 7). Of note, the analysis of ΔT/S versus age resulted in a positive correlation, indicating a more pronounced TL deficit in younger CML patients (P = 0.0017).

Comparison of flow‐FISH and MM–qPCR telomere length assessment techniques for the screening of telomeropathies

“…[22][23][24][25][26] A separate cohort of 89 healthy controls was used for age adaption of TL for MM-qPCR. 27,28 MM-qPCR TL analysis by MM-qPCR followed the original protocol described by Cawthon et al 29,30 Essentially, primer pairs used for telomere amplification were telg 5 -ACACTAAGGTTTGGGTTTGGGTTTGG GTTTGGGTTAGTGT-3 and telc 5 -TGTTAGG TATCCCTATCCCTATCCCTATCCCTATCCCTA ACA-3 , while signal acquisition was at 74°C. For reference, a signal for human beta-globin was acquired at 88°C using the primers hbgu 5 -CGGC GGCGGGCGGCCGGGGCTGGGCGGCTTCAT CCACGTTCACCTTG-3 and hbgd 5 -GCCCGG CCCGCCGCGCCCGTCCCGCCGGAGGAGAA GTCTGCCGTT-3 , as previously described.…”

“…For reference, a signal for human beta-globin was acquired at 88°C using the primers hbgu 5 -CGGC GGCGGGCGGCCGGGGCTGGGCGGCTTCAT CCACGTTCACCTTG-3 and hbgd 5 -GCCCGG CCCGCCGCGCCCGTCCCGCCGGAGGAGAA GTCTGCCGTT-3 , as previously described. 23,27,28 All measurements were carried out as singleblinded in triplicates. Leukocytes from healthy subjects (n = 105) were used for age adaptation of TL, which is given in T/S ratios.…”

Langfristiger Verlauf nach Absetzen von Imatinib-Mesylat bei Patienten mit chronischer myeloischer Leukämie und nicht nachweisbarer minimaler Resterkrankung

“…Neue prognostische Marker wie z.B. die Telomerlängen-Messung [4] werden aktuell versucht zu etablieren, um Patientengruppen mit besonders günstigem Verlauf zu identifizieren, die eventuell im weiteren Verlauf für das Absetzen einer Therapie qualifizieren. Um Patienten in Bezug auf dieses noch unsichere Thema besser beraten zu können, finden inzwischen Instrumente wie «shared decision-making» Einzug in die Welt der CML.…”

Bone marrow mononuclear cell telomere length in acute myeloid leukaemia and high‐risk myelodysplastic syndrome

“…Several studies have examined telomere length and its association to clinical outcome in both myelodysplastic syndromes and acute and chronic leukaemia, but with conflicting results. Generally, telomere length at diagnosis is found to be shorter in patients with haematopoietic stem cell disorders when compared to healthy individuals …”

“…Several studies have examined telomere length and its association to clinical outcome in both myelodysplastic syndromes [17][18][19] and acute and chronic leukaemia, [20][21][22][23][24][25][26][27][28] but with conflicting results.…”