Telomere Length and Telomerase Expression in Atypical Adenomatous Hyperplasia and Small Bronchioloalveolar Carcinoma of the Lung

Abstract

Telomeres are located at the ends of every human chromosome and are subject to shortening at each cycle of cell division in cell senescence and early carcinogenesis. We examined the expression of telomeric DNA in 21 atypical adenomatous hyperplasias (AAHs) and 40 bronchioloalveolar carcinomas (BACs) measuring 2 cm or less in greatest diameter using fluorescent in situ hybridization and the expression of human telomerase reverse transcriptase (hTERT) messenger RNA (mRNA) in 35 AAHs and 37 BACs. The mean numbers of telomeric signals per nucleus were 5.0 in AAH and 7.4 in BAC, each significantly less than for normal cells (14.7; P < .0001), but the mean number of telomeric signals for AAH and BAC was not statistically different (P = .22). In "benign" lung samples, the pattern of expression of hTERT mRNA was barely detected in the nonciliated cells of the bronchioles and alveolar type II cells. Positive expression of hTERT mRNA was recognized in 66% of AAHs and 97% of BACs. Our results demonstrate telomere shortening, indicating its presence in the earliest phase of pulmonary carcinogenesis. Telomere length and telomerase may be involved in carcinogenesis in the lung.

Shortened Telomeres in Serous Tubal Intraepithelial Carcinoma: An Early Event in Ovarian High-grade Serous Carcinogenesis

“…We found shortened telomeres in the majority of STICs compared with adjacent normal tubal epithelium that is consistent with other reports showing telomere shortening in preneoplastic cells in prostate, pancreatic, breast, cervical, colon, lung, and biliary tract carcinomas. 16,18,26,28 Moreover, the majority of HGSCs showed longer telomeres compared with STICs, although a majority were shorter than normal tubal epithelium. These findings argue against STICs being metastases from an ovarian carcinoma as if that were the case, both lesions would have telomeres of similar length.…”

Lymphohistiocytoid mesothelioma of the pleura

“…ISH was per-formed as previously described. 5,6 A pair of oligonucleotide primers (5′GTTCGCGTTGCTAGGCCACC3′ and 5′AGGAC CACTTTATACCAGGG3′) was used for amplification of the DNA flanking part of the BamW repeat sequence of the Epstein-Barr virus (EBV) nuclear antigen 2 gene, resulting in a product of 100 bp. Hybridization was carried out overnight at 42°C in 50% (volume/volume) deionized formamide, 10% Denhardt's solution, 5% (weight/volume) dextran sulfate, 2 ¥ standard saline citrate (SSC), 0.2 mg/mL human placental DNA, and EBER peptide nucleic acid (PNA) probe (Dako Cytomation, Glostrup, Denmark).…”

Current or recent smoking is associated with more variable telomere length in prostate stromal cells and prostate cancer cells

“…Telomeres, which protect the chromosomes from degradation and recombination, can become dysfunctional when there is incomplete replication during DNA synthesis, alterations of telomere-binding proteins involved in telomere maintenance, or DNA damage via oxidative stress. [3][4][5] Though cancer cells, including prostate cancer cells, [6][7][8] typically have significantly shorter telomeres than normal cells from the same tissue, cancer cell maintenance of telomeres improves viability. 9 Among cancer cells, variability in telomere length may indicate more genetic instability, and thus could promote the development of a more aggressive phenotype.…”