TCR Repertoire and Foxp3 Expression Define Functionally Distinct Subsets of CD4+ Regulatory T Cells

Abstract

Despite extensive research efforts to characterize peripheral regulatory T (Treg) cells expressing transcription factor Foxp3, their subset complexity, phenotypic characteristics, TCR repertoire and Ag specificities remain ambiguous. In this study, we identify and define two subsets of peripheral Treg cells differing in Foxp3 expression level and TCR repertoires. Treg cells expressing a high level of Foxp3 and TCRs not used by naive CD4+ T cells present a stable suppressor phenotype and dominate the peripheral Treg population in unmanipulated mice. The second Treg subset, expressing a lower level of Foxp3 and using TCRs shared with naive CD4+ T cells constitutes a small fraction of all Treg cells in unmanipulated mice and enriches Treg population with the same Ag specificities as expressed by activated/effector T cells. This Treg subset undergoes extensive expansion during response to Ag when it becomes a major population of Ag-specific Treg cells. Thus, Treg cells expressing TCRs shared with naive CD4+ T cells have a flexible phenotype and may down-regulate Foxp3 expression which may restore immune balance at the conclusion of immune response or convert these cells to effector T cells producing inflammatory cytokines.

Monotherapeutically Nonactive CTLA-4 Blockade Results in Greatly Enhanced Antitumor Effects When Combined With Tumor-targeted Superantigens in a B16 Melanoma Model

“…Furthermore, a large frequency of the CD4 + Foxp3 + T cells in the lung expressed the SEA-reactive TCR-Vb3 suggesting that the Treg repertoire in tumors induced by C215Fab-SEA was 28 This is in contrast to what is observed in healthy mice where the natural Treg cells express a unique set of TCRs not expressed by naive conventional CD4 + T cells. 29 It is interesting to note that immunization of mice with peptide antigen in adjuvant expanded a Treg population with the same antigen specificities as the activated effector T cells, 29 suggesting that conversion and/or expansion of antigenspecific Treg cells might be a general phenomenon. It is well established that Treg cells constitutively express the CTLA-4 receptor.…”

Altered Connexin 43 Expression Underlies Age-Dependent Decrease of Regulatory T Cell Suppressor Function in Nonobese Diabetic Mice

“…This analysis suggests that, similar to C57BL6 mice, the population of T reg cells in NOD GFP mice is heterogeneous with regard to the level and stability of Foxp3 expression (30, 50). Our study extends earlier reports that T reg cell function deteriorates in aged NOD mice and identifies T reg cells expressing low levels of Foxp3 and conventional CD4 + T cells as cell populations that are mostly affected by age-related dysregulation of Foxp3 expression (22, 51).…”

“…We have routinely observed that a small, but consistent proportion of sorted naive CD4 + T cells from B6 GFP mice upregulated Foxp3 when activated in vitro without exogenous IL-2 and TGF-β (30). In NOD mice we noticed that a larger fraction of effector cells from young NOD GFP mice than from older mice upregulated Foxp3 when cells were activated in vitro (Fig.…”

“…pT reg cells were specifically identified as suppressor cells protecting NOD mice subject to immunotherapy with anti-CD3 antibody and their decreased generation in older NOD mice could be regarded as a contributing factor for diabetes development (14). We have previously suggested that continuous up and downregulation of Foxp3 in conventional CD4 + T cells in response to self-antigens could be an important mechanism of immune tolerance and, based on current data, one could speculate that altered kinetics of this process may impact immunoregulation in NOD mice (30). …”

“…Briefly, single cells were sorted from populations of CD4 + Foxp3 GFP− and T reg cells expressing low and high levels of Foxp3, directly into 96-well PCR plates containing reverse transcription buffer and cDNA was synthesized. Foxp3 and β-actin transcripts were amplifed by two rounds of PCR using nested primers: Foxp3 first round 5′GCCTGCCACCTGGGATCAAT3′ and 5′CACAGATGGAGCCTTGGCCA primers, second round 5′CACCCAGGAAAGACAGCAACC3′ and 5′CTTCTCCTTTTCCAGCTCCAGC3′, β-actin first round 5′GACATGGAGAAGATCTGGCACCA3′ and 5′CTCTTTGATGTCACGCACGATTTC3′ and second round 5′CCTTCTACAATGAGCTGCGTGTGGC3′ and 5′CATGAGGTAGTCTGTCAGGTCC3′ primers (30) (31). …”