Tbx5-mediated expression of Ca2+/calmodulin-dependent protein kinase II is necessary for zebrafish cardiac and pectoral fin morphogenesis

Abstract

Mutations in the T-box transcription factor, TBX5, result in Holt-Oram syndrome (HOS), a human condition in which cardiac development is defective and forelimbs are stunted. Similarly, zebrafish tbx5 morphants and mutants (heartstrings; hst) lack pectoral fins and exhibit a persistently elongated heart that does not undergo chamber looping. Tbx5 is expressed in the developing atrium, ventricle and in pectoral fin fields, but its genetic targets are still being uncovered. In this study, evidence is provided that Tbx5 induces the expression of a specific member of the CaMK-II (the type II multifunctional Ca(2+)/calmodulin-dependent protein kinase) family; this CaMK-II is necessary for proper heart and fin development. Morphants of beta2 CaMK-II (camk2b2), but not the beta1 CaMK-II (camk2b1) paralog, exhibit bradycardia, elongated hearts and diminished pectoral fin development. Normal cardiac phenotypes can be restored by ectopic cytosolic CaMK-II expression in tbx5 morphants. Like tbx5, camk2b2 is expressed in the pectoral fin and looping heart, but this expression is diminished in both tbx5 morphant and hst embryos. Conversely, the introduction of excess Tbx5 into zebrafish embryos and mouse fibroblasts doubles CaMK-II expression. We conclude that beta CaMK-II expression and activity are necessary for proper cardiac and limb morphogenesis. These findings not only identify a morphogenic target for Ca(2+) during heart development, but support implied roles for CaMK-II in adult heart remodeling.

NADPH Oxidase 4 Induces Cardiac Arrhythmic Phenotype in Zebrafish

“…IV). Seven CaMKII genes have been identified in zebrafish so far (41,42). In situ hybridization indicates that CaMKII can be detected since the commencement of zygotic expression (42).…”

The activation of membrane targeted CaMK-II in the zebrafish Kupffer's vesicle is required for left-right asymmetry

“…All zebrafish CaMK-II proteins have a sequence of MHRQE [pT 287 ]VECLK in this region (Rothschild et al, 2009;Rothschild et al, 2007), which is very similar to the phosphopeptide antigen used to create this rabbit polyclonal antibody (MHRQE[pT]VDCLK; Upstate/Millipore) and are therefore predicted to crossreact. E 289 is the only (conservative) difference in the epitope.…”

“…MOs were purchased from Gene Tools (Philomath OR) and are shown for each gene in the 5Ј to 3Ј direction with the sequence corresponding to the start codon underlined and mRNA nucleotide positions indicated. The camk2b1 and camk2b2 MOs have previously been described and optimized (Rothschild et al, 2009 camk2d2: CAGATGGTCAGAGCCATTGTGATG; nucleotides -7 to +17) Mismatch: CAATGCTCACAGCGATTGTCATG Morpholino stocks (1 mM) were stored at -80°C. Prior to injection, MO aliquots were heated to 65°C for 5 minutes, cooled to room temperature and then diluted in Danieau buffer (Westerfield, 1993).…”

“…CaMK-II, the type II multifunctional Ca 2+ /CaM-dependent protein kinase is the most widely expressed member of the CaM kinase family (Tombes et al, 2003) and is subject to highly orchestrated stimulatory and inhibitory autophosphorylations, which then influence its subcellular location and activity towards a variety of substrates (Colbran, 2004;Griffith, 2004;Swulius and Waxham, 2008). Seven transcriptionally active genes encoding CaMK-II have been described in early zebrafish embryos, with one gene containing two open reading frames (Rothschild et al, 2009;Rothschild et al, 2007). During development, CaMK-II is best known for its role in non-canonical Wnt-dependent convergent extension and planar cell polarity (PCP) pathways (Kühl et al, 2000;Sheldahl et al, 2003).…”

MicroRNAs: pleiotropic players in congenital heart disease and regeneration

“…Additionally, the injection of miR-19a also rescued the overall gene expression profile of tbx5 morphants. Nearly half of the genes that were affected by tbx5 depletion appeared to be controlled by miR-19a, including camk2n1a, an inhibitor of CaMKII (calcium/calmodulin-dependent protein kinase II), and mef2ca with nine putative miR-19a binding sites (24,60). In both cases, luciferase assays confirmed a direct regulatory role for miR-19a (24).…”