Taxonomy and 18S rDNA-based phylogeny of Henneguya multiradiatus n. sp. (Cnidaria: Myxobolidae) a parasite of Brochis multiradiatus from Peruvian Amazon

Morphostructural data and phylogenetic relationships of a new cnidarian myxosporean infecting spleen of an economic and ecological important bryconid fish from Brazil

“…The DNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA). Polymerase chain reactions (PCRs) were performed in accordance with Mathews et al [19] and conducted in a final volume reaction of 25 μL, which comprised 10-50 ng of extracted DNA, 0.2 pmol for each primer, 12.5 μL of Dream Taq Green PCR Master Mix (Thermo Scientific) and nuclease-free water. Partial 18S rDNA sequence was amplified using the primer pairs ERIB1 (ACCTGGTTGATCCTGCCAG; [20] with ACT1r (AATTTCACCTCTCGCTGCCA; [21] and Myxgen4F (GTGCCTTGAATAAATCAGAG; [22] with ERIB10 (CTTCCGCAGGTTCACCTACGG; [20]), which amplified two fragments containing approximately 1,000 and 1,200 bp respectively.…”

Molecular diagnostic based on 18S rDNA and supplemental taxonomic data of the cnidarian coelozoic Ceratomyxa (Cnidaria, Myxosporea) and comments on the intraspecific morphological variation

“…As such, there is a fundamental need for constant monitoring to enable diagnosis and timely control of infections by this parasite group in aquarium fish (Mathews et al 2018). Although the Amazon Basin is amongst the most important sources of wild-caught ornamental fishes in the international aquarium industry (Moreau and Coomes 2007), there are few surveys concerning cnidarian myxosporean infections in Amazonian ornamental fish (Mathews et al 2015(Mathews et al , 2017(Mathews et al , 2020a. The three recognised species of the discus genus Symphysodon Heckel, 1840, in the family Cichlidae, are popular, expensive and widely exploited ornamental fish (Bleher et al 2007).…”