Targeting of Dicer-2 and RNA by a Viral RNA Silencing Suppressor in Drosophila Cells

Abstract

A s a form of nucleic acid-based silencing, RNA interference (RNAi) plays essential roles in the cellular response to viral infection in plants and invertebrates (3,13,34,50). In virus-infected cells, aberrant accumulation of viral single-stranded RNA (ssRNA) triggers its conversion into viral replicative intermediate double-stranded RNA (vRI-dsRNA), which is processed by the dsRNA-specific endonuclease Dicer into 21-to 23-nucleotide (nt) small interfering RNAs (siRNAs). Next, the virus-derived siRNAs (viRNAs) are transferred from Dicer to Argonaute (AGO) proteins in the RNA-induced silencing complex (RISC), which then guides the specific degradation of homologous viral ssRNAs (1,8,11,50). In mammals, RNAi directed by viral and cellular microRNAs (miRNAs) also contributes to host innate immunity against viral infection (18,27,35).To combat RNAi-mediated immunity, many plant and animal viruses encode viral suppressors of RNA silencing (VSRs) that target different components in the RNAi machinery. By sequestering dsRNA and siRNA, plant VSRs like turnip crinkle virus (TCV) capsid protein and tombusvirus P19 protein inhibit the production of siRNAs and hinder the incorporation of siRNAs into RISC (25, 41, 52). Additionally, direct interaction with AGO protein is known as a common approach of many plant and insect VSRs, such as cucumber mosaic virus (CMV) 2b protein, TCV P38 protein, sweet potato mild mottle virus (SPMMV) P1 protein, and cricket paralysis virus (CrPV) 1A protein, for suppressing RISC-mediated mRNA cleavage (2,17,36,54).Although Dicer plays essential roles in RNAi immunity, the mechanism by which Dicer can be directly targeted by VSRs is still poorly understood. The core protein of hepatitis C virus (HCV) was previously reported to interact with Dicer; however, whether this interaction is required for the RNA silencing suppression activity of HCV core protein has not been determined (7, 51). Furthermore, several VSRs have been reported to be able to target both RNA and protein components in the RNAi machinery. For example, TCV P38 was shown to target both RNA duplexes and AGO1 (2, 33). A question that remains to be answered, however, is whether an interrelationship exists between diverse activities of VSRs that mediate RNA binding and interaction with RNAi protein components (51).The ideal model for studying viral pathogenesis and RNAi immunity is the persistent infection of Drosophila melanogaster cells with Flock House virus (FHV), the most extensively studied member of the Nodaviridae family, which encodes a well-defined VSR designated B2 (1,6,10,16,29). During the course of FHV infection, 5=-terminal vRI-dsRNA initiated by viral RNA-dependent RNA polymerase (RdRP) triggers RNAi immunity, which is suppressed by B2 protein because B2 associates with RdRP and binds to vRI-dsRNA, thereby leading to the inhibition of the production of siRNAs by Dicer-2 (Dcr-2) (1). Recently, an interaction of FHV B2 with the Piwi-Argonaut-Zwille (PAZ) domain of Dcr-2 was detected in vitro (45). Although whether this in...

Characterization of a Nodavirus Replicase Revealed a de Novo Initiation Mechanism of RNA Synthesis and Terminal Nucleotidyltransferase Activity

“…The BamHI and SalI nuclease sites were introduced during PCR amplification. An internal BamHI nuclease site at position 1333 in the protein A coding sequence was removed through introduction of a synonymous mutation (G1332A) using PCR-mediated mutagenesis according to our standard procedures (20,21,29,41) (primers CTGAaGATCC-GAAAATGCCTGGCCAG and CTGGCCAGGCATTTTCGGATCtTCAG, where the lowercase characters indicate the nucleotides replaced for mutagenesis). The polymerase active site mutagenesis GDD to GAA, containing the double substitution of both Asp-726 and Asp-727 to alanine, was also carried out by PCR-mediated mutagenesis (primers GGGATAAGGTAGGG-GCAGTGTTTGGTGCTGCTAGCCTAAACGCTAATCAC-CAAGGAGAG and CTCTCCTTGGTGATTAGCGTTTAG-GCTAGCAGCACCAAACACTGCCCCTACCTTATCCC).…”

“…The recombinant His 6 -tagged proteins were expressed and purified according to our standard protocol (19,20). Purified proteins were concentrated using Amicon Ultra-15 filters (Millipore, Schwalbach, Germany) and stored in 25 mM HEPES (pH 7.5) at Ϫ20°C according to our standard procedures (20,21,42). Proteins were confirmed by 10% SDS-PAGE and Western blot.…”

“…As a homolog of FHV, WhNV has been well characterized and has provided novel insights about nodaviral subgenomic RNA synthesis (29) and RNA silencing suppression activities (20,21). Our previous study revealed that internal initiation, instead of previously proposed premature termination, is the mechanism governing the subgenomic RNA3 synthesis of WhNV and probably some other nodaviruses (29).…”

A Unique Nodavirus with Novel Features: Mosinovirus Expresses Two Subgenomic RNAs, a Capsid Gene of Unknown Origin, and a Suppressor of the Antiviral RNA Interference Pathway

“…Nodaviruses encode on their subgenomic RNA 3 the B2 protein, which was shown to function as a potent VSR for some family members (30,31,(74)(75)(76). MoNV expresses two subgenomic RNAs, RNA 3 and RNA 4, which are predicted to encode 6.8-and 9.8-kDa proteins, respectively ( Fig.…”

Long Non-Coding RNA-MALAT1 Mediates Retinal Ganglion Cell Apoptosis Through the PI3K/Akt Signaling Pathway in Rats with Glaucoma

“…Gene silencing through RNA interference (RNAi) is a gene-silencing mechanism of eukaryotic cells that participates in antiviral immunity in various organisms [8]. RNAi-based gene treatment has drawn substantial attention due to its greatly specific gene regulation through the degradation of any target mRNA [9].…”