Targeting multicopy prophage genes for the differential diagnosis of Lyme disease

Abstract

The successful treatment of Lyme disease (LD) requires an accurate diagnostic test; however, most tests are insensitive and unspecific. To overcome these challenges, we developed and validated an internally-controlled quantitative PCR (Ter-qPCR) that targets the multicopy terminase large subunit (terL) gene encoded by prophages that are only found in LD-causing bacteria. The terL protein helps phages pack their DNA. Strikingly, the detection limit of the Ter-qPCR was analytically estimated to be 22 copies and one bacterial cell in bacteria spiked blood. Furthermore, significant quantitative differences in terms of the amount of terL detected in healthy individuals and patients with either early or late disease. Together, the data suggests that the prophage-targeting PCR has significant power to provide a differential diagnosis for LD. Prophage encoded markers are prevalent in many other pathogenic bacteria rendering this approach highly applicable to bacterial identification in general, potentially revolutionising the detection of disease.

Combining citizen science and molecular diagnostic methods to investigate the prevalence of Borrelia burgdorferi s.l. and Borrelia miyamotoi in tick pools across Great Britain

“…P184103.EP.01/T.) ( Shan et al, 2018 ). Briefly, a pair of PCR primers and a probe (the Bmer-qPCR) were designed using the PrimerQuest® Tool to amplify a 120 bp region of the Borrelia miyamotoi FR64b terL gene (GenBank accession CP004220.1), The primers were F terBm :AGCCTACCTAGATCCTGCTTAT and R terBm :GGGTCACTTGCTGGTAGTTT.…”