Targeting Lymphotoxin β Receptor with Tumor-Specific T Lymphocytes for Tumor Regression

Abstract

Purpose: One of the impediments of immunotherapy against cancer is the suppression of tumorspecific CTLs in the tumor microenvironment, partly due to the selective inhibition of the perforin pathway and the emergence of Fas-resistant tumors. Therefore, we sought to identify perforinand Fas-independent cytotoxic pathways and explored the potential of targeting LThR with tumor-specific CTLs to induce tumor rejection in vivo. Experimental Design: Fas-resistant tumors were examined for their susceptibility to perforindeficient (pfp) CTLs via CTL adoptive transfer in mouse models of experimental lung metastasis. The specificity of LThR, a cell surface death receptor, in causing tumor rejection by CTLs was analyzed by LThR-specific neutralizing monoclonal antibody in vitro. The specificity and efficacy of LThR in the suppression of established tumors was further investigated by silencing LThR in tumor cells in vivo. Results: pfp CTLs exhibited significant cytotoxicity against Fas-resistant tumors in vivo. The perforin-and Fas-independent cytotoxicity was directly mediated, at least in part, by the adoptively transferred CTLs. It was observed that LThR was expressed on the tumor cell surface, and LTa, LTh, and LIGHT, all of which are ligands for LThR, were either constitutively expressed or activated in the tumor-specific CTLs and primary CD8 + Tcells. Blocking LThR with LThR-specific neutralizing monoclonal antibody decreased CTL cytotoxicity in vitro. Silencing LThR using LThR-specific short hairpin RNA reduced the ability of pfp CTLs to induce tumor rejection in vivo. Conclusion: LThR directly mediates CTL-directed tumor rejection in vivo. Targeting LThR with tumor-specific CTLs is a potential therapeutic approach.

Sub-Lethal Irradiation of Human Colorectal Tumor Cells Imparts Enhanced and Sustained Susceptibility to Multiple Death Receptor Signaling Pathways

“…Blocking LT β R with LT β R-specific neutralizing monoclonal antibody has been reported to decrease CTL cytotoxicity against tumor cells in vitro [32]. Furthermore, silencing LT β R using specific short hairpin RNA was reported to reduce the ability of perforin-deficient CTLs to induce tumor rejection in vivo.…”

“…Death receptors of the tumor necrosis factor receptor (TNF) superfamily such as Fas receptor (Apo1/CD95), death receptor 4/TNF-Related apoptosis-Inducing ligand receptor 1 (DR4/TRAIL-R1), DR5 (TRAIL-R2), TNF-R1, and lymphotoxin-beta receptor (LTβR), are capable of inducing apoptotic signals into tumor cells following ligation with cognate death ligands from anti-tumor immune cells [27]–[32]. However, tumor cells can develop resistance to elimination by immune cells in a process termed immunoediting [33].…”

IRF8 Regulates Acid Ceramidase Expression to Mediate Apoptosis and Suppresses Myelogeneous Leukemia

“…RT-PCR analysis was carried out as previously described (24). The PCR primer sequences are as follows: human IRF8: forward: 5′-CCAGATTTTGAGGAAGTGACG-3′, reverse: 5′-TGGGAGAATGCTGAATGGTGC-3′; mouse IRF8: forward: 5′-CGTGGAAGACGAGGTTACGCTG-3, reverse: 5′-GCTGAATGGTGTGTGTCATAGGC-3′; mouse A-CDase: forward: 5′-CTTTTGGAGGAAATGAGGGG-3′, reverse: 5′-GTCTTGGTCAGTGTGTTCTTGGC-3 ′ and β-actin: forward: 5 ′-ATTGTTACCAACTGGGACGACATG-3′, reverse: 5 ′-CTTCATGAGGTAGTCTGTCAGGTC-3′.…”

Cutting Edge: IRF8 Regulates Bax Transcription In Vivo in Primary Myeloid Cells

“…RT-PCR analysis was carried out as previously described (14). The PCR primer sequences are as follows: mouse Bax: forward: 5’- GGATGCGTCCACCAAGAAGC -3’, reverse: 5’-GGAGGAAGTCCAGTGTCCAGCC-3’.…”