Targeting glucosylceramide synthase upregulation reverts sorafenib resistance in experimental hepatocellular carcinoma

Abstract

Evasive mechanisms triggered by the tyrosine kinase inhibitor sorafenib reduce its efficacy in hepatocellular carcinoma (HCC) treatment. Drug-resistant cancer cells frequently exhibit sphingolipid dysregulation, reducing chemotherapeutic cytotoxicity via the induction of ceramide-degrading enzymes. However, the role of ceramide in sorafenib therapy and resistance in HCC has not been clearly established. Our data reveals that ceramide-modifying enzymes, particularly glucosylceramide synthase (GCS), are upregulated during sorafenib treatment in hepatoma cells (HepG2 and Hep3B), and more importantly, in sorafenib-resistant cell lines. GCS silencing or pharmacological GCS inhibition sensitized hepatoma cells to sorafenib exposure. GCS inhibition, combined with sorafenib, triggered cytochrome c release and ATP depletion in sorafenib-treated hepatoma cells, leading to mitochondrial cell death after energetic collapse. Conversely, genetic GCS overexpression increased sorafenib resistance. Of interest, GCS inhibition improved sorafenib effectiveness in a xenograft mouse model, recovering drug sensitivity of sorafenib-resistant tumors in mice. In conclusion, our results reveal GCS induction as a mechanism of sorafenib resistance, suggesting that GCS targeting may be a novel strategy to increase sorafenib efficacy in HCC management, and point to target the mitochondria as the subcellular location where sorafenib therapy could be potentiated.

Melatonin‐induced increase in sensitivity of human hepatocellular carcinoma cells to sorafenib is associated with reactive oxygen species production and mitophagy

“…Speedtools tissue DNA extraction (Biotools B&M Labs, Madrid, Spain) was used for total DNA extraction and purification following the vendor instructions. Changes in mitochondrial DNA content was measured in comparison with nuclear DNA . Mitochondrial DNA: mtMinArc Fw 5′ CTAAATAGCCCACACGTTCCC 3′, Rv 5′ AGAGCTCCCGTGAGTGGTTA 3′ (GenBank # ).…”

Sphingolipid metabolism in cancer signalling and therapy

“…In fact, GCS expression was associated with poor prognosis in patients with oral cavity cancers 60 . Molecular or pharmacological inhibition of GCS attenuated resistance to chemotherapeutic drugs in head and neck cancer or hepatocellular carcinoma cells 61,62 . In addition, inhibition of GCS restored p53-dependent apoptosis, which was reported to be ceramide-dependent, in ovarian cancer cells expressing mutant p53 (REF.…”

Sphingolipid abnormalities in cancer multidrug resistance: Chicken or egg?

“…The fact that GluCer degradation was not reduced in MCF7/Adr cells pointed to increased GluCer synthesis in ABCB1-overexpressing cells. Indeed, increased GCS activity has now been associated with MDR phenotypes across multiple cancer cell lines [164-168] in mouse models [169], and cancer-derived tissues [170-172]. Furthermore, pharmacologic inhibitors of de novo ceramide synthesis (fumonisin B 1 , L-cycloserine) [162], GCS (PPMP) [162] and ABCB1 (verapamil, tamoxifen, CsA), which appear to inhibit GCS activity at therapeutic concentrations (5 μM) [173], all reduced augmented GluCer levels in MCF7/Adr cells, indicating that both deregulated de novo ceramide synthesis and GCS activity regulate increased GluCer associated with MDR.…”