Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences

Abstract

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

Exploitation of a Very Small Peptide Nucleic Acid as a New Inhibitor of miR-509-3p Involved in the Regulation of Cystic Fibrosis Disease-Gene Expression

“…PNA molecules are resistant to protease and nuclease degradation and recognize with a high affinity complementary fragments of DNA or RNA [26]. Many studies have been performed on the binding capability of PNAs and on the topological way in which they can recognize nucleic acids in single strand, duplex, or quadruplex arrangements to form heteroduplex, heterotriplex, and heteroquadruplex complexes [27–31] or to act as quadruplex ligands, respectively [32, 33]. The anti-miRNA activity of a PNA can occur in the nucleus by targeting the pre-miRNA or in the cytoplasm by binding the pre-miRNA and/or the mature miRNA [17].…”

Sequencing and G-Quadruplex Folding of the Canine Proto-Oncogene KIT Promoter Region: Might Dog Be Used as a Model for Human Disease?

“…On the contrary, a triarylpyridine derivative was found to reduce the stability of G-4 in KIT and increments KIT gene expression in HGC-27 cells [26]. In addition, both synthetic DNA (PNA) and peptide (peptidomimetic) analogues were found to be able to efficiently recognize h_kit1 [27], [28].…”

Multivalent L Kγ-PNA oligomers bind to a human telomere DNA G-rich sequence to form quadruplexes

“…10, 12, 13 There are many strategies for targeting quadruplexes, including small molecules 14 , engineered DNA-binding proteins 15, 16 , and complementary oligonucleotides such as locked nucleic acids (LNAs) 17, 18 and peptide nucleic acids (PNAs). 19–21 …”

“…solubility, bioavailability, and functionality). Some common strategies include conjugating moieties to PNA termini 21 and/or modifying the PNA backbone. 33–37 Modifications at the -position of the PNA backbone have been well-documented to increase binding affinity and solubility, as well as to provide a convenient handle to attach additional functionality.…”