Tandem linkage and unusual RNA splicing of the T-cell receptor beta-chain variable-region genes.

Chou, Hubert S.; Anderson, Steven J.; Louie, Marjorie C.; Godambe, Sandip A.; Pozzi, Maria Rosa; Behlke, Mark A.; Hüppi, Konrad; Loh, Dennis Y.

doi:10.1073/pnas.84.7.1992

Cited by 94 publications

(42 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…V05.1 and V05.2 are considered together together since these genes are homologous and the hybridization conditions used in these experiments do not distinguish them. V1,5.3, a related pseudogene (38), is not detected under these conditions (data not shown). Considering the total number of singly expressed V3 genes in the three hybridoma panels, V,5.1 and V15.2 comprise 12%, 9.1%, and 0.6% of the expressed Vp genes in B10 (H-2b), B10.Q (H-2q), and B10.BR (H-2k) mice, respectively.…”

Section: Discussionmentioning

confidence: 95%

See 1 more Smart Citation

An analysis of T-cell receptor variable region gene expression in major histocompatibility complex disparate mice.

Bill

Appel

Palmer

1988

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

To define the impact of major histocompatibility complex (MHC)-encoded glycoproteins on the selection of the T-cell receptor repertoire, we have determined the frequency with which T-cell receptor variable region (V. and Vat) genes are expressed in T cells from MHC disparate mice. Approximately 500 T-cell hybridomas were generated from each of three strains of MIIC congenic mice [B1O (H-2b), (H-2b), three B10.BR (H-2k), and five B10.Q (H-2q)] were separately cultured for 2 days in the presence of Con A (3 jug/ml) and separately fused to the thymoma BW5147 by standard methods (19). All fusions were plated at a low density such that >90% of the hybridomas were clonal. Hybridomas expressing >2 Va, or >2 V,3 genes were assumed to be nonclonal and were not considered into the data base. These fusions generated 555, 583, and 491 hybrids from B10, B1O.BR, and B1O.Q Con A blasts, respectively. Cells (107) from each hybrid were grown, washed in balanced salt solution, and frozen for RNA extraction at a later time.RNA Extraction and Hybridization Analyses. RNA was isolated by a slight modification of the protocol described by Cheley and Anderson (20); instead of passage through a 22-g needle, lysates were sonicated for 10 sec with a fine probe to shear genomic DNA. Then, 3 x 105 cell equivalents of each RNA was applied to a nitrocellulose filter (12 x 8 cm) using a %-well blotting manifold and a 12-channel pipetter. Twenty replicate nitrocellulose filters were prepared from each set of 94 hybridoma RNAs. BW5147 RNA was applied to each filter and served as a positive control for constant region (Cal) Statistical Analysis of the Data. The entire distribution of V gene expression in the three panels of T-cell hybridomas was subjected toX2 analysis (36) and the Vgenes (V1a3, V,35, V11I, and V,312) making a major contribution to the total x2 value were identified. The data for the Va3, V1,5, Vp1,1 genes were Abbreviations: MHC, major histocompatibility complex; TCR, Tcell receptor; V, variable; D, diversity; J, joining; C, constant. tTo whom reprint requests should be sent at * address. 9184The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

show abstract

Section: Discussionmentioning

confidence: 95%

“…Among 1900 hybrids we have examined (Table 2; unpublished observations), only 6 (0.3%) were found that express Va7 genes. (23,38). The data in Table 3 These differences are statistically significant [B1O.Q vs. B1O.BR (P < 0.0004) and B10 vs. B1O.BR (P < 0.05)].…”

mentioning

confidence: 80%

An analysis of T-cell receptor variable region gene expression in major histocompatibility complex disparate mice.

Bill

Appel

Palmer

1988

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…BC, BV, and BJ primer sequences were as described earlier (18), except BV8.3 (TGCTGGCAACCTTCAAAT AGGA) and BV13 (AGGCCTAAAGGAACTAACTCCAC). As BV5.3 (22), BV17 (23), and BV19 (24) are not functional in B10.D2 mice, they were not amplified. BV-BJ repertoires were analyzed for BV2, BV3, BV4, BV5.1, BV6, BV7, BV8.1-3, BV9, BV14, and BV16 genes.…”

Section: Tcrb Repertoirementioning

confidence: 99%

A Profound Alteration of Blood TCRB Repertoire Allows Prediction of Cerebral Malaria

Collette

Bagot

Ferrandiz

et al. 2004

The Journal of Immunology

View full text Add to dashboard Cite

Cerebral malaria (CM) is one of the severe complications of Plasmodium infection. In murine models of CM, Tαβ cells have been implicated in the neuropathogenesis. To obtain insights into the TCRB repertoire during CM, we used high throughput CDR3 spectratyping and set up new methods and software tools to analyze data. We compared PBL and spleen repertoires of mice infected with Plasmodium berghei ANKA that developed CM (CM+) or not (CM−) to evidence modifications of the TCRB repertoire associated with neuropathology. Using distinct statistical multivariate methods, the PBL repertoires of CM+ mice were found to be specifically altered. This alteration is partly due to recurrently expanded T cell clones. Strikingly, alteration of the PBL repertoire can be used to distinguish between CM+ and CM−. This study provides the first ex vivo demonstration of modifications of Tαβ cell compartment during CM. Finally, our original approach for deciphering lymphocyte repertoires can be transposed to various pathological conditions.

show abstract

“…Northern blots containing SL12.4 poly(A)+ RNA were hybridized with a C,31-specific probe. Figure 1B shows that there was no evidence for mature 1.3- were derived either from published work (1,8,14) or from our sequence analysis of the expressed V35.1 element in SL12.4 cells.…”

mentioning

confidence: 96%

T cell receptor-beta mRNA splicing: regulation of unusual splicing intermediates.

Qian¹,

Theodor²,

Carter³

et al. 1993

Mol. Cell. Biol.

View full text Add to dashboard Cite

The expression of functional T cell receptor-n (TCR-13) transcripts requires the activation of programmed DNA rearrangement events. It is not clear whether other mechanisms dictate TCR-1 mRNA levels during thymic ontogeny. We examined the potential role of RNA splicing as a regulatory mechanism. As a model system, we used an immature T cell clone, SL12.4, that transcribes a fully rearranged TCR-13 gene but essentially lacks mature 1.3-kb TCR-1 transcripts in the cytoplasm. Abundant TCR-13 splicing intermediates accumulate in the nucleus of this cell clone. These splicing intermediates result from inefficient or inhibited excision of four of the five TCR-13 introns; the only intron that is efficiently spliced is the most 5' intron, IVSL.The focal point for the regulation appears to be IVSlc31 and IVS2cp1, since unusual splicing intermediates that have cleaved the 5' splice site but not the 3' splice site of these two introns accumulate in vivo. The block in 3' splice site cleavage is of interest since sequence analysis reveals that these two introns possess canonical splice sites. A repressional mechanism involving a labile repressor protein may be responsible for the inhibition of RNA splicing since treatment of SL12.4 cells with the protein synthesis inhibitor cycloheximide reversibly induces a rapid and dramatic accumulation of fully spliced TCR-13 transcripts in the cytoplasm, concomitant with a decline in TCR-13 pre-mRNAs in the nucleus. This inducible system may be useful for future studies analyzing the underlying molecular mechanisms that regulate RNA splicing.The T cell receptor (TCR) for antigen is a multisubunit receptor composed of two variable chains that recognize antigen (either the TCR-ot and -I or and several CD3 invariant chains that are involved in signal transduction (2). TCR-13 chains are of particular interest for several reasons, including the fact that they recognize socalled superantigens found in the natural environment (18 The expression of TCR-P transcripts during T cell maturation has been well studied. Truncated (1.0-kb) TCR-0 transcripts are expressed very early in murine ontogeny (at least as early as day 14 of mouse gestation) along with CD3--y, -8, -£, and -t transcripts (11,16,42 thymocytes undergo rearrangement events in the thymus, but it also may be due to alterations in transcriptional or posttranscriptional regulatory events. On day 17, TCR-ot transcripts become apparent in the fetal thymus (11,42). This event roughly coincides with the appearance of cell surface TCR-ot3 protein on a small proportion of fetal thymocytes (42). Thus, the TCR-ao chain appears to be the limiting subunit that controls the surface expression of TCR-aIt protein early in ontogeny. TCR-P protein has also been detected on the surface of immature thymocytes or cell lines in the absence of the TCR-oL chain (21, 33), but its function in this context is not yet known.The transcriptional regulation of the TCR-13 gene has been studied in cell culture. A tissue-specific enhancer element has been defined 3'...

show abstract

Tandem linkage and unusual RNA splicing of the T-cell receptor beta-chain variable-region genes.

Cited by 94 publications

References 31 publications

An analysis of T-cell receptor variable region gene expression in major histocompatibility complex disparate mice.

An analysis of T-cell receptor variable region gene expression in major histocompatibility complex disparate mice.

A Profound Alteration of Blood TCRB Repertoire Allows Prediction of Cerebral Malaria

T cell receptor-beta mRNA splicing: regulation of unusual splicing intermediates.

Contact Info

Product

Resources

About