TAM Receptors Are Not Required for Zika Virus Infection in Mice

Hastings, Andrew K.; Yockey, Laura J.; Jagger, Brett W.; Hwang, Jesse; Uraki, Ryuta; Gaitsch, Hallie; Parnell, Lindsay A.; Cao, Bin; Mysorekar, Indira U.; Rothlin, Carla V.; Fikrig, Erol; Diamond, Michael S.; Iwasaki, Akiko

doi:10.1016/j.celrep.2017.03.058

Cited by 131 publications

(130 citation statements)

References 62 publications

Supporting

Mentioning

117

Contrasting

Unclassified

Order By: Relevance

“…Our studies implicate additional members of the TAM/TIM family of transmembrane receptors, TYRO3, MER, and TIM1, as likely entry portals as their expression was largely confined to VZ and SVZ progenitors along with AXL. Recent studies in mice further indicate that neither single nor combined deletion of two of the three TAM receptors can alleviate ZIKV infection (Hastings et al, 2017), suggesting that expression of even a single receptor may render cells susceptible to the virus.…”

Section: Discussionmentioning

confidence: 99%

Self-Organized Cerebral Organoids with Human-Specific Features Predict Effective Drugs to Combat Zika Virus Infection

et al. 2017

View full text Add to dashboard Cite

Summary The human cerebral cortex possesses distinct structural and functional features that are not found in the lower species traditionally used to model brain development and disease. Accordingly, considerable attention has been placed on the development of methods to direct pluripotent stem cells to form human brain-like structures termed organoids. However, many organoid differentiation protocols are inefficient and display marked variability in their ability to recapitulate the three-dimensional architecture and course of neurogenesis in the developing human brain. Here, we report optimized organoid culture methods that efficiently and reliably produce cortical and basal ganglia structures similar to those in the human fetal brain in vivo. Neurons within the organoids are functional and exhibit network-like activities. We further demonstrate the utility of this organoid system for modeling the teratogenic effects of Zika virus on the developing brain and identifying more susceptibility receptors and therapeutic compounds that can mitigate its destructive actions.

show abstract

Section: Discussionmentioning

confidence: 99%

Self-Organized Cerebral Organoids with Human-Specific Features Predict Effective Drugs to Combat Zika Virus Infection

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Mice exhibiting a weight loss of Ͼ20% of initial body weight or severe neurologic disease were euthanized. Viremia levels were examined at 1, 3, 5, 7, and 9 days postinfection by extracting total RNA from murine blood using TRIzol reagent, and qRT-PCR was performed to examine the ZIKV levels as previously described (66). The primer sequences were as follows: ZIKV, forward (TTGGTCATGATACTGCTGATTGC) and reverse (CCTTCCACAAAGTCCCTATTGC); mosquito Rp40, forward (GCTATGACAAGCTTGCCCCCA) and reverse (TCATCAGCACCTCCAGCT); and mouse ␤-actin, forward (GA TGACGATATCGCTGCGCTG) and reverse (GTACGACCAGAGGCATACAGG).…”

Section: Methodsmentioning

confidence: 99%

Aedes aegypti NeSt1 Protein Enhances Zika Virus Pathogenesis by Activating Neutrophils

Hastings

Uraki

Gaitsch

et al. 2019

J Virol

Self Cite

View full text Add to dashboard Cite

Saliva from the mosquito vector of flaviviruses is capable of changing the local immune environment, leading to an increase in flavivirus-susceptible cells at the infected bite site. In addition, an antibody response to specific salivary gland (SG) components changes the pathogenesis of flaviviruses in human populations. To investigate whether antigenic SG proteins are capable of enhancing infection with Zika virus (ZIKV), a reemerging flavivirus primarily transmitted by the Aedes aegypti mosquito, we screened for antigenic SG proteins using a yeast display library and demonstrate that a previously undescribed SG protein we term neutrophil stimulating factor 1 (NeSt1) activates primary mouse neutrophils ex vivo. Passive immunization against NeSt1 decreases pro-interleukin-1␤ and CXCL2 expression, prevents macrophages from infiltrating the bite site, protects susceptible IFNAR Ϫ/Ϫ IFNGR -/-(AG129) mice from early ZIKV replication, and ameliorates virus-induced pathogenesis. These findings indicate that NeSt1 stimulates neutrophils at the mosquito bite site to change the immune microenvironment, allowing a higher level of early viral replication and enhancing ZIKV pathogenesis. IMPORTANCE When a Zika virus-infected mosquito bites a person, mosquito saliva is injected into the skin along with the virus. Molecules in this saliva can make virus infection more severe by changing the immune system to make the skin a better place for the virus to replicate. We identified a molecule that activates immune cells, called neutrophils, to recruit other immune cells, called macrophages, that the virus can infect. We named this molecule neutrophil-stimulating factor 1 (NeSt1). When we used antibodies to block NeSt1 in mice and then allowed Zika virus-infected mosquitoes to feed on these mice, they survived much better than mice that do not have antibodies against NeSt1. These findings give us more information about how mosquito saliva enhances virus infection, and it is possible that a vaccine against NeSt1 might protect people against severe Zika virus infection.

show abstract

“…The TAM receptor AXL, through soluble intermediates growth arrest-specific 6 (Gas6) was recently shown to support ZIKV infection of human foreskin fibroblast [9], glial cells [10], neural stem cells [11,12], and foetal endothelial cells [13]. However, recent findings also suggest that AXL is not required in ZIKV infection in mouse models [14][15][16], neural progenitor cells, and cerebral organoids [17]. These contrasting findings suggested that AXL is not involved in ZIKV entry.…”

Section: Introductionmentioning

confidence: 99%

Cell surface α2,3-linked sialic acid facilitates Zika virus internalization

Tan

Hor

Kwek

et al. 2019

Emerging Microbes & Infections

View full text Add to dashboard Cite

The emergence of neurotropic Zika virus (ZIKV) raised a public health emergency of global concern. ZIKV can cross the placental barrier and infect foetal brains, resulting in microcephaly, but the pathogenesis of ZIKV is poorly understood. With recent findings reporting AXL as a type I interferon antagonist rather than an entry receptor, the exact entry mechanism remains unresolved. Here we report that cell surface sialic acid plays an important role in ZIKV infection. Removal of cell surface sialic acid by neuraminidase significantly abolished ZIKV infection in Vero cells and human induced-pluripotent stem cells-derived neural progenitor cells. Furthermore, knockout of the sialic acid biosynthesis gene encoding UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase resulted in significantly less ZIKV infection of both African and Asian lineages. Huh7 cells deficient in α2,3-linked sialic acid through knockout of ST3 β-galactoside-α2,3-sialyltransferase 4 had significantly reduced ZIKV infection. Removal of membrane-bound, un-internalized virus with pronase treatment revealed the role of sialic acid in ZIKV internalization but not attachment. Sialyllactose inhibition studies showed that there is no direct interaction between sialic acid and ZIKV, implying that sialic acid could be mediating ZIKV-receptor complex internalization. Identification of α2,3-linked sialic acid as an important host factor for ZIKV internalization provides new insight into ZIKV infection and pathogenesis.

show abstract

TAM Receptors Are Not Required for Zika Virus Infection in Mice

Cited by 131 publications

References 62 publications

Self-Organized Cerebral Organoids with Human-Specific Features Predict Effective Drugs to Combat Zika Virus Infection

Self-Organized Cerebral Organoids with Human-Specific Features Predict Effective Drugs to Combat Zika Virus Infection

Aedes aegypti NeSt1 Protein Enhances Zika Virus Pathogenesis by Activating Neutrophils

Cell surface α2,3-linked sialic acid facilitates Zika virus internalization

Contact Info

Product

Resources

About