T cell proliferation and adaptive immune responses are critically regulated by protein phosphatase 4

Abstract

The clonal expansion of activated T cells is pivotal for the induction of protective immunity. Protein phosphatase 4 (PP4) is a ubiquitously expressed serine/threonine phosphatase with reported functions in thymocyte development and DNA damage responses. However, the role of PP4 in T cell immunity has not been thoroughly investigated. In this report, our data showed that T cell-specific ablation of PP4 resulted in defective adaptive immunity, impaired T cell homeostatic expansion, and inefficient T cell proliferation. This hypo-proliferation was associated with a partial G1-S cell cycle arrest, enhanced transcriptions of CDK inhibitors and elevated activation of AMPK. In addition, resveratrol, a known AMPK activator, induced similar G1-S arrests, while lentivirally-transduced WT or constitutively-active AMPKa1 retarded the proliferation of WT T cells. Further investigations showed that PP4 co-immunoprecipitated with AMPKa1, and the over-expression of PP4 inhibited AMPK phosphorylation, thereby implicating PP4 for the negative regulation of AMPK. In summary, our results indicate that PP4 is an essential modulator for T cell proliferation and immune responses; they further suggest a potential link between PP4 functions, AMPK activation and G1-S arrest in activated T cells.

DNA Methylation Profile in Human Cord Blood Mononuclear Leukocytes From Term Neonates: Effects of Histological Chorioamnionitis

“…Hypomethylation of PPP4C may result in abnormal cortical development, increasing the risk of neurodevelopmental disorders. PPP4C has also been shown to be involved in immune regulation through proliferation and expansion of regulatory T cells and subsequent adaptive immunity (27). We speculate that the fetal systemic inflammatory response from HCA leads to changes in methylation pattern in leukocytes.…”

“…Notable hypermethylated probe-IDs with gene names included AGR2 (Anterior Gradient Protein 2), which plays a role in asthma and mucin production ( 24 ), and OTX2 (Orthodenticle Homeobox 2), which interacts with nitric oxide ( 25 ). The top hypomethylated probe-IDs with gene names included MIER2 (Mesoderm Induction Early Response Protein 2), which regulates histone deacetylases ( 26 ), and PPP4C (Protein Phosphatase 4 Catalytic Subunit), a regulator of T-regulatory cells ( 27 ).…”

“…The hypermethylated genes have roles in asthma (VGLL4, AGR2) ( 24 , 28 ), neurologic development (AGAP1, OTX2) ( 29 , 30 ), and immune regulation (SCAMP5, SLC11A1) ( 31 , 32 ). The hypomethylated genes have roles in immune regulation (PPP4C) ( 27 ), transcription regulation (MIER2) ( 26 ), and inflammation (ABCC8) ( 33 ).…”

Detection and quantification of dengue virus using a novel biosensor system based on dengue NS3 protease activity

“…The PCR NS4B/ N10 NS5 fragment was cloned into pcDNA3.1(-) using XhoI/AflII restriction endonucleases to create the plasmid pNS4B/ N10 NS5. The Cre recombinase cDNA sequence (GenBank: AB449974.1, 114–1142) was amplified via PCR from CD4cre mouse (Jackson Laboratory, Bar Harbor, ME, USA) genomic DNA [ 31 ]. The SV40 NLS (ccaagaagaagaggaaggtg, encoding PKKKRKVG) was fused to the 5’ end of the Cre recombinase cDNA sequence using PCR to generate 5’-EcoRI and 3’-AflII-HindIII restriction sites.…”

PP4 deficiency leads to DNA replication stress that impairs immunoglobulin class switch efficiency

“…Furthermore, PP4 plays essential roles in DNA damage responses and DNA repair by dephosphorylating DBC1 [29] and KAP1 [30–32], and regulates cell cycle progression by dephosphorylating γH2AX and RPA2 [33–36]. Lastly, several lines of evidence support a crucial function for PP4 in cell proliferation [37–40].…”