Systemic and Cerebral Iron Homeostasis in Ferritin Knock-Out Mice

Abstract

Ferritin, a 24-mer heteropolymer of heavy (H) and light (L) subunits, is the main cellular iron storage protein and plays a pivotal role in iron homeostasis by modulating free iron levels thus reducing radical-mediated damage. The H subunit has ferroxidase activity (converting Fe(II) to Fe(III)), while the L subunit promotes iron nucleation and increases ferritin stability. Previous studies on the H gene (Fth) in mice have shown that complete inactivation of Fth is lethal during embryonic development, without ability to compensate by the L subunit. In humans, homozygous loss of the L gene (FTL) is associated with generalized seizure and atypical restless leg syndrome, while mutations in FTL cause a form of neurodegeneration with brain iron accumulation. Here we generated mice with genetic ablation of the Fth and Ftl genes. As previously reported, homozygous loss of the Fth allele on a wild-type Ftl background was embryonic lethal, whereas knock-out of the Ftl allele (Ftl-/-) led to a significant decrease in the percentage of Ftl-/- newborn mice. Analysis of Ftl-/- mice revealed systemic and brain iron dyshomeostasis, without any noticeable signs of neurodegeneration. Our findings indicate that expression of the H subunit can rescue the loss of the L subunit and that H ferritin homopolymers have the capacity to sequester iron in vivo. We also observed that a single allele expressing the H subunit is not sufficient for survival when both alleles encoding the L subunit are absent, suggesting the need of some degree of complementation between the subunits as well as a dosage effect.

Ferritin, cellular iron storage and regulation

“…Of interest is that its deletion in the duodenal villi makes the animals iron overloaded, while the deletion of IRP that causes overexpression of ferritin makes the mice iron deficient , evidence that fully support the role of ferritin in iron absorption as originally proposed by the mucosal block hypothesis. Altogether these data show that the H ferritin has an important protective role while the L ferritin has not, since its deficiency does not seem to affect iron homeostasis or oxidative damage . Ferritin role in embryogenesis is important, but it has not been well explored so far.…”

H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

“…The Ftl-/-mice are characterized by systemic and brain iron dyshomeostasis (42). This L-deficient phenotype was previously described also in human, where homozygous loss of function mutation in the L-ferritin gene is associated with generalized seizure and atypical restless leg syndrome (43).…”

“…This clearly demonstrates that maintenance of a specific H/L ratio of ferritin is an element of a basic cellular homeostatic mechanism. Indeed, the inactivation of ferritin H gene (Fth) in mice is lethal during embryonic development (41), whereas knock-out of the L gene (Ftl) is compatible with life, even if the Ftl-/-showed a significant decrease in the percentage of newborn mice (42).…”

Distinct iron homeostasis in C57BL/6 and Balb/c mouse strains

“…mRNA (800 ng) was used to synthesize cDNA for qRT‐PCR using SYBR green (Quanta) according to the manufacturer's instruction. The following primers were used to assess gene expression: hepcidin (Hamp) 5′‐AGAAAGCAGGGCAGACATTG‐3′ and 5′‐CACTGGGAATTGTTACAGCATT‐3′ (Masaratana et al., 2013); ferroportin (Fpn) 5′‐TTGTTGTTGTGGCAGGAGAA‐3′ and 5′‐ AGCTGGTCAATCCTTCTAATGG‐3′ (Masaratana et al., 2013); DMT1 5′‐GGCTTTCTTATGAGCATTGCCTA‐3′ and 5′‐GGAGCACCCAGAGCAGCTTA‐3′ (Dupic et al., 2002); DcytB 5′‐GCAGCGGGCTCGAGTTTA‐3′ and 5′‐TTCCAGGTCCATGGCAGTCT‐3′ (Dupic et al., 2002); Hephaestin (Heph) 5′‐TTGTCTCATGAAGAACATTACAGCAC‐3′ and 5′‐CATATGGCAATCAAAGCAGAAGA‐3′ (Dupic et al., 2002); SFT 5′‐CTGTGCTCATTGAAGAGGACCTT‐3′ and 5′‐TCTGGTTGCTTTCTCAGTCACG‐3′ (Dupic et al., 2002); Tf 5′‐TGTAGCCTTTGTGAAACACCAGA‐3′ and 5′‐TCGGCAGGGTTCTTTCCTT‐3′ (Lyoumi et al., 2007); TfR1 5′‐TCATGAGGGAAATCAATGATCGTA‐3′ and 5′‐GCCCCAGAAGATATGTCGGAA‐3′ (Dupic et al., 2002); TfR2 5′‐GCTGGGACGGAGGTGACTT‐3′ and 5′‐GAGTTGTCCAGGCTCACGTACA‐3′ (Gao et al., 2010); FTH 5′‐CTCATGAGGAGAGGGAGCAT‐3′ and 5′‐GTGCACACTCCATTGCATTC‐3′ (Li et al., 2015); FTL 5′‐GTCCCGTGGATCTGTGTCT‐3′ and 5′‐AGGAGCTAACCGCGAAGAGA‐3′ (Li et al., 2015); SOD2 5′‐ CAGCCTCCCAGACCTGCCTT −3′ and 5′‐ GTGCAGGCTGAAGAGCGACC −3′ (Srinivasan et al., 2012); Gpx 5′‐ GGCACCACGATCCGGGACTA‐3′ and 5′‐ AAATTGGGCTCGAACCCGCC‐3′ (Srinivasan et al., 2012); 36B4 5′–TCCAGGCTTTGGGCATCA–3′ and 5′–CTTTATTCAGCTGCACATCACTCAGA–3′ (Chassaing et al., 2012). 36B4 was used as the reference gene to normalize relative mRNA expression by Ct (2 ΔΔCt ) method.…”