Systemic Analysis of the DNA Replication Regulator MCM Complex in Ovarian Cancer and Its Prognostic Value

Li, Yukun; Zou, Juan; Zhang, Qunfeng; Quan, Feifei; Cao, Lu; Zhang, Xiaodi; Liu, Jue; Wu, Daichao

doi:10.3389/fonc.2021.681261

Cited by 12 publications

(15 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Currently, with the expected development of high-throughput sequencing technology, various public databases and bioinformatics algorithms provide a scientific basis and tool in searching hub genes for further exploration of cancer research 31 . In our study, we found that 3 genes (CENPH, ESM1 and HIST1H2AE) were closely correlated with the formation, development and progression of OC via the WGCNA network 32 and random survival forest variable screening 10 based on the GSE66957 and GSE54388 datasets.…”

Section: Discussionmentioning

confidence: 99%

Validation of ESM1 Related to Ovarian Cancer and the Biological Function and Prognostic Significance

Li¹,

Zeng²,

Guan³

et al. 2023

Int. J. Biol. Sci.

Self Cite

View full text Add to dashboard Cite

Background: Ovarian cancer (OC), a serious gynecological malignant disease, remains an enormous challenge in early diagnosis and medical treatment. Based on the GEO and TCGA databases in R language, endothelial cell-specific molecule 1 (ESM1) was confirmed separately with the bioinformatic analysis tool. ESM1 has been demonstrated to be upregulated in multiple cancer types, but the oncogenic mechanism by which ESM1 promotes OC is still largely unknown. Methods: In this study, we used WGCNA and random survival forest variable screening to filter out ESM1 in OC differentially expressed genes (DEGs). Next, we confirmed the mRNA and protein levels of ESM1 in OC samples via PCR and IHC. The correlation between the ESM1 level and clinical data of OC patients was further confirmed, including FIGO stage, lymph node metastasis, and recurrence. The role of ESM1 in OC development was explored by several functional experiments in vivo and in vitro. Then, the molecular mechanisms of ESM1 were further elucidated by bioinformatic end experimental analysis. Results: ESM1 was significantly upregulated in OC and was positively correlated with PFS but negatively correlated with OS. ESM1 knockdown inhibited cell proliferation, apoptosis escape, the cell cycle, angiogenesis, migration and invasion in multiple experiments. Moreover, GSVA found that ESM1 was associated with the Akt pathway, and our results supported this prediction. Conclusion: ESM1 was closely correlated with OC development and progression, and it could be considered a novel biomarker and therapeutic target for OC patients.

show abstract

Section: Discussionmentioning

confidence: 99%

Validation of ESM1 Related to Ovarian Cancer and the Biological Function and Prognostic Significance

Li¹,

Zeng²,

Guan³

et al. 2023

Int. J. Biol. Sci.

Self Cite

View full text Add to dashboard Cite

show abstract

“…The second function was to regulate the DNA binding activity of a group of nuclear factors, which was related to the pathway of gene damage ( Friedberg et al, 2000 ; Wu and Zhou, 2009 ). MCM5 ( Li et al, 2021 ) was a member of the MCM family of chromatin binding proteins, which could interact with at least two other members of the family. The encoding proteins were up-regulated in the cell cycle from G0 to G1/S, and may be involved in cell cycle regulation.…”

Section: Discussionmentioning

confidence: 99%

DNA Damage Repair-Related Genes Signature for Immune Infiltration and Outcome in Cervical Cancer

Wang

Sun

2022

Front. Genet.

View full text Add to dashboard Cite

Background: The mechanism of DNA damage repair plays an important role in many solid tumors represented by cervical cancer.Purpose: The purpose of this study was to explore the effect of DNA damage repair-related genes on immune function of patients with cervical cancer, and to establish and evaluate a prognosis model based on DNA damage repair-related genes.Methods: In the study, we analyzed the genes related to DNA damage and repair, and obtained two subtypes (F1 and F2). We selected two groups of samples for different selection, and studied which pathways were enriched expression. For different subtypes, the immune score was explored to explain immune infiltration. We got the key genes through screening, and established the prognosis model through the key genes. These 11 key genes were correlated with the expression of common Clusters of Differentiation (CD) genes in order to explore the effects of these genes on immunity.Results: Through the Least absolute shrinkage and selection operator (LASSO) method, we screened 11 genes from 232 candidate genes as the key genes for the prognosis score. Through the Kaplan-Meier method, four genes (HAP1, MCM5, RNASEH2A, CETN2) with significant prognostic significance were screened into the final model, forming a Nomogram with C-index of 0.716 (0.649–1.0).Conclusion: In cervical cancer, DNA damage repair related genes and immune cell infection characteristics have certain association, and DNA damage repair related genes and immune cell infection characteristics can effectively predict the prognosis.

show abstract

“…The RT-qPCR assay was executed as illustrated previously ( 27 ). Primers used were listed as followed: GAPDH forward: GTCTCCTCTGACTTCAACAGCG, GAPDH reverse: ACCACCCTGTTGCTGTAGCCAA; GSTM3 forward: CGAAGCCAATGGCTGGATGTGA, GSTM3 reverse: GTTGTGCTTGCGAGCGATGTAG; GSTM4 forward: TGGAGAACCAGGCTATGGACGT, GSTM4 reverse: CCAGGAACTGTGAGAAGTGCTG;…”

Section: Methodsmentioning

confidence: 99%

Comprehensive analysis of the glutathione S-transferase Mu (GSTM) gene family in ovarian cancer identifies prognostic and expression significance

Zhang

Zou

et al. 2022

Front. Oncol.

Self Cite

View full text Add to dashboard Cite

BackgroundOvarian cancer (OC) is one of the most common types of gynecologic tumor over the world. The Glutathione S-transferase Mu (GSTM) has five members, including GSTM1-5. These GSTMs is involved in cell metabolism and detoxification, but their role in OC remains unknown.MethodsData from multiple public databases associated with OC and GSTMs were collected. Expression, prognosis, function enrichment, immune infiltration, stemness index, and drug sensitivity analysis was utilized to identify the roles of GSTMs in OC progression. RT-qPCR analysis confirmed the effect of AICAR, AT-7519, PHA-793887 and PI-103 on the mRNA levels of GSTM3/4.ResultsGSTM1-5 were decreased in OC samples compared to normal ovary samples. GSTM1/5 were positively correlated with OC prognosis, but GSTM3 was negatively correlated with OC prognosis. Function enrichment analysis indicated GSTMs were involved in glutathione metabolism, drug metabolism, and drug resistance. Immune infiltration analysis indicated GSTM2/3/4 promoted immune escape in OC. GSTM5 was significantly correlated with OC stemness index. GSTM3/4 were remarkedly associated with OC chemoresistance, especially in AICAR, AT-7519, PHA-793887 and PI-103.ConclusionGSTM3 was negatively correlated with OC prognosis, and associated with OC chemoresistance and immune escape. This gene may serve as potential prognostic biomarkers and therapeutic target for OC patients.

show abstract

Systemic Analysis of the DNA Replication Regulator MCM Complex in Ovarian Cancer and Its Prognostic Value

Cited by 12 publications

References 57 publications

Validation of ESM1 Related to Ovarian Cancer and the Biological Function and Prognostic Significance

Validation of ESM1 Related to Ovarian Cancer and the Biological Function and Prognostic Significance

DNA Damage Repair-Related Genes Signature for Immune Infiltration and Outcome in Cervical Cancer

Comprehensive analysis of the glutathione S-transferase Mu (GSTM) gene family in ovarian cancer identifies prognostic and expression significance

Contact Info

Product

Resources

About