Systematic comparison of single-chain Fv antibody-fusion toxin constructs containing Pseudomonas Exotoxin A or saporin produced in different microbial expression systems

Abstract

BackgroundAntibodies raised against selected antigens over-expressed at the cell surface of malignant cells have been chemically conjugated to protein toxin domains to obtain immunotoxins (ITs) able to selectively kill cancer cells. Since latest generation immunotoxins are composed of a toxic domain genetically fused to antibody fragment(s) which confer on the IT target selective specificity, we rescued from the hydridoma 4KB128, a recombinant single-chain variable fragment (scFv) targeting CD22, a marker antigen expressed by B-lineage leukaemias and lymphomas. We constructed several ITs using two enzymatic toxins both able to block protein translation, one of bacterial origin (a truncated version of Pseudomonas exotoxin A, PE40) endowed with EF-2 ADP-ribosylation activity, the other being the plant ribosome-inactivating protein saporin, able to specifically depurinate 23/26/28S ribosomal RNA. PE40 was selected because it has been widely used for the construction of recombinant ITs that have already undergone evaluation in clinical trials. Saporin has also been evaluated clinically and has recently been expressed successfully at high levels in a Pichia pastoris expression system. The aim of the present study was to evaluate optimal microbial expression of various IT formats.ResultsAn anti-CD22 scFv termed 4KB was obtained which showed the expected binding activity which was also internalized by CD22+ target cells and was also competed for by the parental monoclonal CD22 antibody. Several fusion constructs were designed and expressed either in E. coli or in Pichia pastoris and the resulting fusion proteins affinity-purified. Protein synthesis inhibition assays were performed on CD22+ human Daudi cells and showed that the selected ITs were active, having IC50 values (concentration inhibiting protein synthesis by 50% relative to controls) in the nanomolar range.ConclusionsWe undertook a systematic comparison between the performance of the different fusion constructs, with respect to yields in E. coli or P. pastoris expression systems and also with regard to each constructs specific killing efficacy. Our results confirm that E. coli is the system of choice for the expression of recombinant fusion toxins of bacterial origin whereas we further demonstrate that saporin-based ITs are best expressed and recovered from P. pastoris cultures after yeast codon-usage optimization.Electronic supplementary materialThe online version of this article (doi:10.1186/s12934-015-0202-z) contains supplementary material, which is available to authorized users.

Optimization of construct design and fermentation strategy for the production of bioactive ATF-SAP, a saporin based anti-tumoral uPAR-targeted chimera

“…pSAP and pATF-SAPHis with the sequence encoding saporin optimized for the expression in yeast have been previously generated [12]. pATF-SAP plasmid was prepared by Xho I/ Not I double digestion of pATF-SAPHis to recover the ATF sequence to insert in the Xho I/ Not I cut pHis4KBoptG4S-SAPopt [29] recipient vector. The pHisATF-SAP was obtained by the insertion of an ATF fragment generated by PCR (PmlIATF forward primer 5AGCAATGAACTTCATCAAGTTCCATCGAAC; ATFRevNotI reverse primer CAGTAGCGGCCGCTTTTCCATCTGC) into the pHis4KBoptG4S-SAPopt plasmid digested with Pml I and Not I.…”

Recombinant antibody production evolves into multiple options aimed at yielding reagents suitable for application-specific needs

“…In a recent contribution [ 27 ], the yields of two constructs formed of the same scFv fused to the sequences corresponding to a toxin of either bacterial ( Pseudomonas exotoxin A) or plant (saporin) origin were compared in E. coli and P. pastoris . Exotoxin A-scFv was apparently expressed better in bacteria, whereas saporin-scFv production was more successful in yeast.…”

Ribosome Inactivating Proteins: Exploiting Plant Weapons to Fight Human Cancer

“…However, in some cases the protein may accumulate inside the cell as an insoluble fraction from which the full RIP activity is not easily recovered. Several targeting domains belonging to chimeric fusions require complex post-traslational modifications to reach their native conformation and thus they have to be produced in eukaryotic expression systems, like the methylotrophic yeast Pichia pastoris that also allows safe, efficient secretion of the heterologous protein in the culture medium followed by an easier purification [19].…”