Synthesis of novel products in vitro by an RNA-dependent RNA polymerase

Song, Chuanzheng; Simon, Anne

doi:10.1128/jvi.69.7.4020-4028.1995

Cited by 22 publications

(10 citation statements)

References 46 publications

(59 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The TCV RdRp, similarly to many other viral RdRps, replicates the TCV genomic RNA and all the associated RNAs by recognizing specific promoter sequences/structures present on these RNAs and initiating RNA synthesis de novo (Song and Simon, 1994, 1995; Guan et al ., 1997). In addition, the TCV RdRp is capable of primer elongation, but only from the 3′ end of the plus strand and only in the presence of a functional promoter (i.e.…”

Section: Resultsmentioning

confidence: 99%

“…The priming stem in the absence of the motif1‐hairpin cannot drive efficient 3′‐TX with the TCV RdRp. Thus, the TCV RdRp, which is naturally promoter dependent and capable of de novo initiation (Song and Simon, 1994, 1995), is different from most of the DNA‐dependent DNA polymerases, reverse transcriptases and T7 DNA‐dependent RNA polymerase (Konarska and Sharp, 1989; Cazenave and Uhlenbeck, 1994) that only require base pairing of the very 3′‐end bases between the primer and the template for strand elongation. In contrast, the promoter‐dependent RdRps may require or favor the proximity of a promoter or promoter‐like element in order to use primers efficiently.…”

Section: Discussionmentioning

confidence: 99%

“…3′‐TX products were treated with S1 nuclease or RNase H in the presence of 1 μg of loop1 oligo (5′‐AATTCGTGAAAA‐3′, complementary to the loop region of CD‐27, see Figure 1C) as described (Song and Simon, 1994, 1995) at 37°C for 1 h. After phenol/chloroform extraction and ammonium acetate/isopropanol precipitation, the products were analyzed on a 20 cm‐long denaturing 5% polyacrylamide–8 M urea gel, followed by autoradiography and densitometry (Nagy et al ., 1997). The data were normalized based on the amount of template‐directed radioactive UTP incorporated into the 3′‐TX products and the molar amount of the template RNA in the RdRp reaction.…”

Section: Methodsmentioning

confidence: 99%

“…The radioactively labeled 3′‐TX product of CD‐27 obtained from a 200 μl RdRp reaction was gel purified, then hybridized with loop1 oligo followed by digestion with RNase H as described above. The RNase H‐cleaved product was gel purified and subjected to reverse transcription (RT) PCR with primer T7C3′ and MMLV reverse transcriptase (Song and Simon, 1995). Oligodeoxynucleotides T7C3′ and Har1PCR (5′‐GAATTCCCTGGCTGTTTCCC‐3′) were used for PCR.…”

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Dissecting RNA recombination invitro: role of RNA sequences and the viral replicase

1998

View full text Add to dashboard Cite

Molecular mechanisms of RNA recombination were studied in turnip crinkle carmovirus (TCV), which has a uniquely high recombination frequency and non-random crossover site distribution among the recombining TCV-associated satellite RNAs. To test the previously proposed replicase-driven template-switching mechanism for recombination, a partially purified TCV replicase preparation (RdRp) was programed with RNAs resembling the putative in vivo recombination intermediates. Analysis of the in vitro RdRp products revealed efficient generation of 3'-terminal extension products. Initiation of 3'-terminal extension occurred at or close to the base of a hairpin that was a recombination hotspot in vivo. Efficient generation of the 3'-terminal extension products depended on two factors: (i) a hairpin structure in the acceptor RNA region and (ii) a short base-paired region formed between the acceptor RNA and the nascent RNA synthesized from the donor RNA template. The hairpin structure bound to the RdRp, and thus is probably involved in its recruitment. The probable role of the base-paired region is to hold the 3' terminus near the RdRp bound to the hairpin structure to facilitate 3'-terminal extension. These regions were also required for in vivo RNA recombination between TCV-associated sat-RNA C and sat-RNA D, giving crucial and direct support for a replicase-driven template-switching mechanism of RNA recombination.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Dissecting RNA recombination invitro: role of RNA sequences and the viral replicase

1998

View full text Add to dashboard Cite

show abstract

“…Deletion of the 3Ј-terminal three cytidylates (LS3⌬3C) relieved transcriptional repression similarly to wt satC with the equivalent deletion (C⌬3C). Since the products of the TCV RdRp-mediated in vitro transcription reactions are double stranded (36), while minus strands synthesized in vivo are likely single stranded, the in vitro assay examines the initiation event for only a single round of transcription. Thus, it is possible that the CCCA element functions downstream of ini-tiation of minus-strand synthesis in an event of replication that cannot be evaluated by using this in vitro assay.…”

Section: In Vivo Genetic Selection Of the Satc Ls And Rs Regionsmentioning

confidence: 99%

Short Internal Sequences Involved in Replication and Virion Accumulation in a Subviral RNA of Turnip Crinkle Virus

Sun

Zhang

Simon

2005

J Virol

View full text Add to dashboard Cite

cis-acting sequences and structural elements in untranslated regions of viral genomes allow viral RNAdependent RNA polymerases to correctly initiate and transcribe asymmetric levels of plus and minus strands during replication of plus-sense RNA viruses. Such elements include promoters, enhancers, and transcriptional repressors that may require interactions with distal RNA sequences for function. We previously determined that a non-sequence-specific hairpin (M1H) in the interior of a subviral RNA (satC) associated with Turnip crinkle virus is required for fitness and that its function might be to bridge flanking sequences (X. Sun and A. E. Simon, J. Virol. 77:7880-7889, 2003). To establish the importance of the flanking sequences in replication and satC-specific virion repression, segments on both sides of M1H were randomized and subjected to in vivo functional selection (in vivo SELEX). Analyses of winning (functional) sequences revealed three different conserved elements within the segments that could be specifically assigned roles in replication, virion repression, or both. One of these elements was also implicated in the molecular switch that releases the 3 end from its interaction with the repressor hairpin H5, which is possibly involved in controlling the level of minus-strand synthesis.Replication of positive-strand RNA viruses is a multistep process mediated by the virally encoded RNA-dependent RNA polymerase (RdRp). First, the invading plus-strand genomic RNA is released from the capsid, recruited by ribosomes, and then translated to produce components of the RdRp. Next, in a poorly understood process that may require the clearance of ribosomes (1), the genomic plus-strand RNA switches from a translation template to a replication template. RdRp and possibly other viral or host factors (16) form an initiation complex at the promoter and initiate de novo or primer-directed transcription of the complementary minus strand. The minus-strand intermediate is then used as a template for synthesis of plus strands. The relative levels of the two strands are often highly asymmetric, with ratios of up to 1,000 plus strands for every minus strand produced (2). This asymmetric accumulation of complementary strands suggests the existence of a second switch, one that represses minus-strand synthesis, thereby constraining the RdRp to synthesize plus strands. The switch from minus-strand to plus-strand synthesis is likely mediated by cis-acting elements that allow or deny access of the RdRp to the plus-strand promoter or 3Ј-terminal sequences.Diverse RNA secondary or tertiary structures such as hairpins, pseudoknots, and tRNA-like structures exist in viral 3Ј untranslated regions that can play important roles in virus replication (4). Some viruses regulate switches that occur during viral RNA replication by changing the conformation of 3Ј-proximal structures, which may be mediated by one or more unstable base pairs occurring between complementary short sequences located within and outside hairpins (13,23,25,45). For examp...

show abstract

Natural Recombination among Plant Virus Genomes: Evidence from Tobraviruses

MacFarlane

1997

Seminars in Virology

View full text Add to dashboard Cite

Synthesis of novel products in vitro by an RNA-dependent RNA polymerase

Cited by 22 publications

References 46 publications

Dissecting RNA recombination invitro: role of RNA sequences and the viral replicase

Dissecting RNA recombination invitro: role of RNA sequences and the viral replicase

Short Internal Sequences Involved in Replication and Virion Accumulation in a Subviral RNA of Turnip Crinkle Virus

Natural Recombination among Plant Virus Genomes: Evidence from Tobraviruses

Contact Info

Product

Resources

About