Synthesis and storage in rat thyroid C-cells.

Thomas, Gerry; Neonakis, E.; Davies, H. G.; Wheeler, Malcolm H.; Williams, E. D.

doi:10.1177/42.8.7913105

Cited by 8 publications

(11 citation statements)

References 4 publications

(6 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sequence was as follows: 5′‐ACAGGATGTGAATGTCTTCCAGAAGAAGTTCTTGCAGCCAGC‐3′. This probe has been previously shown to demonstrate SS mRNA in normal thyroid C cells and pancreatic islet (D) cells in the rat (Thomas et al . 1994).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Expression of somatostatin mRNA and peptides in C‐cell tumours of the thyroid gland in Han Wistar rats

Pilling

Jones

Turton

2004

Int J Experimental Path

View full text Add to dashboard Cite

C-cell tumours of the thyroid gland are among the most common spontaneous neoplasms of the laboratory rat. With the exception of calcitonin, little attention has been paid to the secretory peptides of C cells during the development of neoplasia. Of these peptides, somatostatin (SS) is of particular interest because it has been shown to have a direct anti-secretory effect on both thyroid follicular and C cells in vitro. In the present study, in situ hybridization and immunohistochemistry were used to investigate the expression of SS mRNA and SS peptides, in normal C cells and a range of spontaneous proliferative C-cell lesions in the Han Wistar rat. It was confirmed that a small minority of C cells in the normal rat thyroid gland produce and store SS peptides; however, approximately half of all C-cell adenomas and C-cell carcinomas stained positively for SS mRNA and peptides. SS expression was also observed in all metastatic deposits of carcinomas in drainage lymph nodes. From these observations, it appears that C-cell tumours are more likely to develop from SS-expressing stem cells, rather than from non-SS-expressing stem cells. In addition, a lack of differentiation of neoplastic C cells, or reversion to more primitive cell types, could account for increased number of cells expressing SS in C-cell tumours relative to the normal C-cell population. Finally, the mean percentage of cells that stained positively for SS mRNA and peptides appeared to be significantly higher in small C-cell tumours, suggesting that SS may have exerted a growth-controlling influence on these lesions.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Thomas et al . (1994) first showed that only a small proportion of normal C cells in the rat are capable of producing and storing SS.…”

mentioning

confidence: 99%

Expression of somatostatin mRNA and peptides in C‐cell tumours of the thyroid gland in Han Wistar rats

Pilling

Jones

Turton

2004

Int J Experimental Path

View full text Add to dashboard Cite

show abstract

“…Both antibodies against calcitonin and CGRP marked almost all of the C-cells in the mouse thyroid, even though CGRP immunoreactivity is not always detected in all thyroid C-cells in several animals, including the mouse (Zabel et al 1988;Arias et al 1989;Sawicki and Zabel 1999;Thomas et al 1994). The IHC co-localization of the convertases and calcitonin has also been reported in human medullary thyroid carcinomas, which contained elevated levels of these enzymes compared to normal thyroid C-cells (Tomita 2000).…”

Section: Discussionmentioning

confidence: 99%

“…Several ICC studies have demonstrated that C-cells are located not only in the thyroid but also in the parathyroid glands in some mammalian species (Kameda 1971). Moreover, several immunohistochemical (IHC) studies have detected calcitonin-gene related peptide (CGRP), derived as a splicing variant from a gene that also encodes calcitonin, in the C-cells of some laboratory rodents, including the mouse (Zabel et al 1988;Arias et al 1989;Wimalawansa 1991;Thomas et al 1994;Sawicki and Zabel 1999). Although the antiserum against CGRP does not always react against all of the C-cells, the expression of CGRP in C-cells is confirmed by a study using ISH techniques (van Lieshout et al 1995).…”

mentioning

confidence: 99%

Immunocytochemical Localization of Prohormone Convertases PC1 and PC2 in the Mouse Thyroid Gland and Respiratory Tract

Kurabuchi

Tanaka

2002

J Histochem Cytochem.

View full text Add to dashboard Cite

S U M M A R YWe examined immunocytochemical localization of the prohormone convertases, PC1 and PC2, in the thyroid gland and respiratory tract of the adult mouse using the indirect enzyme-and immunogold-labeled antibody methods for light and electron microscopy, respectively. In the thyroid gland, PC1-and/or PC2-immunoreactive cells were cuboidal, scattered in the follicular epithelium and in the interfollicular spaces. When serial sections were immunostained with anti-calcitonin, anti-PC1, anti-calcitonin-gene-relatedpeptide (CGRP), and anti-PC2 sera, respectively, localization of both PC1 and PC2 was restricted to the calcitonin/CGRP-producing parafollicular cells. In the respiratory tract, only PC1 immunoreactivity was observed in the basal granulated neuroendocrine cells, which were scattered in the tracheal epithelium. Consecutive sections immunostained with anti-PC1 and anti-CGRP sera showed that a subpopulation of these PC1-immunoreactive cells contained CGRP. Double immunogold electron microscopy of the thyroid parafollicular cells revealed that calcitonin-and/or CGRP-immunopositive secretory granules were also labeled with both PC1 and PC2. These findings suggest that procalcitonin is proteolytically cleaved by PC2 alone or by PC2 together with PC1, and that the proCGRP is cleaved by PC1.

show abstract

“…Our study does not require this confirmation of CT presence in the counted secretory granules because it is well known that at least 99% of all Ccells in the adult rat thyroid contain CT [13][14][15]. Although present in the secretory granules of these cells are also other peptides (e.g., CT gene-related peptide, somatostatin, and neurotensin), they coexist with CT [13,16].…”

mentioning

confidence: 90%

The Efficiency of Calcitonin Transport across the C-Cell–Blood Barrier in Rat Thyroid

Krasnoperov¹,

Грачев²,

Glumova³

et al. 2006

J. Physiol. Sci

View full text Add to dashboard Cite

This paper studies calcitonin (CT) transport across the C-cell-blood (CCB) barrier in normal rats. The efficiency of this transport is expressed as endogenous calcitonin bioavailability (F CT ), i.e., that portion of CT molecules extruded by the thyroid C-cell basal pole that enters the circulating blood. Because currently F CT cannot be estimated directly, a novel methodology was used for its estimation. The essence of this methodology is to assess the CT level before and after the CCB barrier, to study these input-output CT relationships mathematically, and to find the F CT range allowed by the relationships. In this context, the subplasmalemmal granule numerical density in the C-cell basal pole (X) and the CT concentration in the right ventricular blood (Y) were found to be highly correlated: r xy = 0.922, P < 0.001; the covariance coefficient ρ xy = 0.9980, P < 0.0001. Clearly, the overall variance of these input-output relationships in the covariance model ( = 6.32) is explained, specifically, by CT retention (R CT ) variability at the CCB transport stages. The greater the R CT mean value in the studied rats, the greater is the impact of R CT variability on Var xy . The estimated variance caused by R CT (Var CCBR ) makes it possible to determine R CT and F CT (F CT = 100% -R CT ). Thus we estimated Var CCBR as Var CCBR < Var xy -CV RIA 2 , where CV RIA 2 is CT assay variance:= 6.00% (P ≥ 0.95). We then estimated F CT as the value range that does not contradict the Var CCBR obtained: 62% < F CT < 100% (P ≥ 0.95). Var xy Var CCBRKey words: calcitonin, C-cell-blood barrier, biological availability, statistical modeling, thyroid gland.The tissue-blood interface is effected by cell-blood (CB) barriers located on the border line between specific organ cells and the blood flowing in close proximity to them. CB barriers ensure a selective supply of substances the cells need, as well as a removal of catabolic wastes into the circulation. A characteristic feature of CB barriers in the endocrine glands is their involvement in hormone transfer to systemic circulation. Therefore these barriers play another very important role that until now has not received due attention, i.e., the role associated with providing the body with the optimum supply of any certain biologically active substance.At the point where the thyroid C-cell comes near the perifollicular blood capillary, a C-cell-blood (CCB) barrier is formed whose phenomenology and ultrastructural parameters we have studied previously [1]. Because of its borderline position, the CCB system can regulate calcitonin (CT) transport to the bloodstream. However, until now the regulatory function of the CCB barrier has not been investigated, which is largely explained by the fact that there are no data on CT kinetics across the CCB barrier. Our paper presents a step forward in this direction, its purpose being to evaluate the efficiency of endogenous CT transport across the CCB barrier in normal rat thyroid. METHODSMethodology. This section deals with (i) the basic...

show abstract

Synthesis and storage in rat thyroid C-cells.

Cited by 8 publications

References 4 publications

Expression of somatostatin mRNA and peptides in C‐cell tumours of the thyroid gland in Han Wistar rats

Expression of somatostatin mRNA and peptides in C‐cell tumours of the thyroid gland in Han Wistar rats

Immunocytochemical Localization of Prohormone Convertases PC1 and PC2 in the Mouse Thyroid Gland and Respiratory Tract

The Efficiency of Calcitonin Transport across the C-Cell–Blood Barrier in Rat Thyroid

Contact Info

Product

Resources

About