Synthesis and in vitro evaluation of potential antichagasic hydroxymethylnitrofurazone (NFOH-121): a new nitrofurazone prodrug

Chin, Chung Man; Güido, Rafael Victório Carvalho; Martinelli, Tatiane Favarato; Goncalves, M F; Polli, Michelle Carneiro; Botelho, Kátia Cirlene Alves; Varanda, Eliana Aparecida; Colli, Walter; Miranda, Maria Terêsa Machini de; Ferreira, Elizabeth Igne

doi:10.1016/j.bmc.2003.07.004

Cited by 77 publications

(80 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…With intention to develop more selective drugs, with low toxicity and more specific targets, a reciprocal prodrug of nitrofurazone, the hydroxymethylnitrofurazone (NFOH-121), was developed and showed higher trypanocidal activity than nitrofurazone and benznidazol in all stages (Chung 2003). To confirm the trans-splicing reaction, the RNase protection procedure was done using the same probe described by Ullu and Tschudi (1990) [a complementary antisense sequence to the region of the 7 to 105 nt of SL RNA of T. cruzi Y strain (5'-CGCTATTATTGATACA GTTTCTGTACTATATTGGTACGCGAAGCTTCCAA CCCCCTCTGGCGGTTATGTTTGGGCAATTTCTTTT GACCGGGGTCG-3') cloned in pBS vector].…”

mentioning

confidence: 99%

Trypanosoma cruzi: establishment of permeable cells for RNA processing analysis with drugs

Ambrósio

Barbosa

Vianna

et al. 2004

Mem. Inst. Oswaldo Cruz

View full text Add to dashboard Cite

Pre-mRNA maturation in trypanosomatids occurs through a process called trans-splicing which involves excision of introns and union of exons in two independentIn the process of pre-mRNA maturation, known as splicing, the introns (non-coding regions of polypeptides) are removed from primary transcripts and the exons (coding regions) joined to form a contiguous sequence specifying a functional polypeptide. It was observed that the process is dependent on ribonucleoproteins, small molecules of RNA binding proteins with different forms and sizes, assembling a macromolecular complex called the spliceosome, where the maturation reaction takes place (Leningher et al. 1995). In trypanosomes, all the RNAs are processed by a mechanism different from that in mammals (cis-splicing) called trans-splicing, a process that involves the union of the exons in two independent transcripts. However, in recent studies it was observed that cis-splicing can also occur in the gene PAP (poly-A polymerase) of Trypanosoma brucei and T. cruzi, suggesting that both trans and cis-splicing, occur in these parasites, with a predominance of trans-splicing (Mair et al. 2000).The SL RNA or miniexon is a primary transcript synthesized independently of pre-mRNA and trans-spliced in all nuclear mRNA. The majority of mRNAs is synthesized as polycistronic precursors (Agabian 1990). T. brucei SL RNA contains an unusual cap structure consisting of 7-methylguanosine linked to four modified nucleosides. This modification of trypanosomatid SL sequence might be required for the function of the SL RNA in trans-splic-

show abstract

mentioning

confidence: 99%

Trypanosoma cruzi: establishment of permeable cells for RNA processing analysis with drugs

Ambrósio

Barbosa

Vianna

et al. 2004

Mem. Inst. Oswaldo Cruz

View full text Add to dashboard Cite

show abstract

“…Hydroxymethylnitrofurazone was synthesized as previously described [1]; DM-β-CD (degree of substitution~1.7-1.9) was obtained as a gift from the Roquette Company (Lestren, France). The solutions were prepared with ultrapure deionized water with maximum resistivity up to 18.2 megohms (or conductivity of 0.055 μS, Waters ultrapure water system).…”

Section: Reagents and Chemicalsmentioning

confidence: 99%

“…Thus, new and better drugs are urgently needed to face this serious situation. The driving force for antichagasic drug development has been the selectivity of action, through the knowledge of biochemical targets in the parasite [1]. Hydroxymethylnitrofurazone (NFOH, Fig.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Hydroxymethylnitrofurazone:Dimethyl-β-cyclodextrin Inclusion Complex: A Physical–Chemistry Characterization

et al. 2007

Self Cite

View full text Add to dashboard Cite

Hydroxymethylnitrofurazone (NFOH) is active against Trypanosoma cruzi; however, its low solubility and high toxicity precludes its current use in treatment of parasitosis. Cyclodextrin can be used as a drug carrier system, as it is able to form inclusion (host-guest) complexes with a wide variety of organic (guest) molecules. Several reports have shown the interesting use of modified β-cyclodextrins in pharmaceutical formulation, to improve the bioavailability of drugs and to decrease their toxicity. The aim of this work was to characterize inclusion complexes formed between NFOH and dimethyl-β-cyclodextrin (DM-β-CD) by complexation/release kinetics and solubility isotherm experiments using ultraviolet (UV)-visible spectrophotometry and by the measurement of the dynamics information obtained from T 1 relaxation times and diffusion (DOSY) experiments using nuclear magnetic resonance (NMR) spectroscopy. The complex was prepared at different NFOH and DM-β-CD molar ratios. The UV-visible measurements were recorded in a spectrophotometer, and NMR experiments were recorded at 20°C on a NMR spectrometer (Varian Inova) operating at 500 MHz. Longitudinal relaxation times were obtained by the conventional inversion-recovery method and the DOSY experiments were carried out using the BPPSTE sequence. The kinetics of complexation revealed that 30 h is enough for stabilization of the NFOH absorbance in presence of cyclodextrin. Solubility isotherm studies show a favorable complexation and increase in solubility when NFOH interacts with cyclodextrin. The analysis of the NMR-derived diffusion coefficients and T 1 relaxation times shows that in the presence of DM-β-CD, NFOH decreases its mobility in solution, indicating that this antichagasic compound interacts with the cyclodextrin cavity. The release kinetics assays showed that NFOH changes its release profile when in the presence of cyclodextrin due to complexation. This study was focused on the physicochemical characterization of drug-delivery formulations that may serve as potentially new therapeutic options for the treatment of Chagas' disease.

show abstract

“…Utilizaram-se diferentes métodos, adaptados da literatura, para a obtenção do hemissuccinato de NFOH. Embora simples, essa reação é dificultada pela baixa reatividade do NFOH e por sua instabilidade especialmente em meio ácido (CHUNG et al, 2003).…”

Section: Síntese Do Hidroximetilnitrofuralunclassified

Candidatos a leishmanicidas, antichagásicos e tuberculostáticos: estudo da síntese de fármacos dirigidos de hidroximetilnitrofural com manana para liberação específica em macrófagos

Primi¹

View full text Add to dashboard Cite

Synthesis and in vitro evaluation of potential antichagasic hydroxymethylnitrofurazone (NFOH-121): a new nitrofurazone prodrug

Cited by 77 publications

References 15 publications

Trypanosoma cruzi: establishment of permeable cells for RNA processing analysis with drugs

Trypanosoma cruzi: establishment of permeable cells for RNA processing analysis with drugs

Hydroxymethylnitrofurazone:Dimethyl-β-cyclodextrin Inclusion Complex: A Physical–Chemistry Characterization

Candidatos a leishmanicidas, antichagásicos e tuberculostáticos: estudo da síntese de fármacos dirigidos de hidroximetilnitrofural com manana para liberação específica em macrófagos

Contact Info

Product

Resources

About