Synchronously electricity generation and degradation of biogas slurry using microbial fuel cell

Wang, Fang; Zhang, Deli; Shen, Xiaoxu; Liu, Weidong; Yi, Weiming; Li, Zhihe; Liu, Shanjian

doi:10.1016/j.renene.2019.04.063

Cited by 30 publications

(12 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Wang et al [ 126 ] designed a dual-chamber microbial fuel cell with corn stalk biogas slurry as the anode ( Figure 3 ). The anode compartment and cathode compartment of the biofuel cell are separated by a proton exchange membrane and the proton exchange membrane is pre-treated with an H 2 O 2 solution (30%, 80 °C), deionized water and H 2 SO 4 solution (0.5 mol/L) for 1 h and then washed three times with deionized water.…”

Section: Key Technologymentioning

confidence: 99%

A Review of Key Technologies and Trends in the Development of Integrated Heating and Power Systems in Agriculture

Zhou

Yang

et al. 2021

Entropy

View full text Add to dashboard Cite

Petroleum agriculture, characterized by mechanization and chemistry, is developing rapidly in China. However, petroleum agriculture has not only brought food safety problems, but also caused great obstacles to the sustainable development of society. In view of the disadvantages of oil agriculture, we provide an upgrading plan for energy systems in agriculture. This work can help reduce carbon emissions and improve food security. We introduce the most advanced technologies in Chinese agricultural development and the technical scope includes new agricultural energy power generation, agricultural energy use and the safe operation of agricultural energy systems. We describe the detailed data of agricultural bioenvironmental and energy engineering to clarify the level of agricultural energy efficiency in China. The overall conclusion of this paper is that the deep integration of agriculture and energy internet has become the development trend of agricultural energy systems.

show abstract

Section: Key Technologymentioning

confidence: 99%

A Review of Key Technologies and Trends in the Development of Integrated Heating and Power Systems in Agriculture

Zhou

Yang

et al. 2021

Entropy

View full text Add to dashboard Cite

show abstract

“…(GACTGGAGTTCCTTGGVACCCGAGAATTCCAGACTACHVGGGTATCTAATCC) [19,20], followed by a second round of ampli cation with the same primer pairs. After ampli cation, gel electrophoresis was performed to detect the ampli ed products.…”

Section: Microbial Analysismentioning

confidence: 99%

Electricity generation and pollutants removal of landfill leachate by osmotic microbial fuel cells with different forward osmosis membranes

Jiang

Huang

Huang³

et al. 2021

Preprint

View full text Add to dashboard Cite

In this study, thin-film composite with embedded polyester screen, cellulose triacetate with a cast nonwoven and cellulose triacetate with embedded polyester screen (CTA-ES) were examined as the intermediate membranes in osmotic microbial fuel cells (OsMFCs). The reactors were fed with actual landfill leachate and the performance was studied in two operation modes: active layer facing draw solution and active layer facing feed solution (AL-FS). The OsMFC with CTA-ES exhibited the best energy generation (maximum power density: 0.44 W m-2) and pollutant removal efficiency (ammonia nitrogen: 70.12 ± 0.28%, total nitrogen: 74.04 ± 0.33%) in the AL-FS mode, which could be ascribed to the lowest internal resistance (236.75 ohm) and highest microbial richness. Pseudomonas was the highest proportion of microbial in OsMFCs. The results of this study has demonstrated the potential of OsMFCs for landfill leachate treatment.

show abstract

“…Then, according to the manufacturer's (Shenggong Biotechnology Co., Ltd., Shanghai, China) instructions, DNA was extracted from samples using the Soil DNA kit. The rst round of polymerase chain reaction (PCR) ampli cation was performed using the primers targeting the V3/V4 region of the bacterial 16S rRNA genes: 341F (CCCTACACGACGCTCTTCCGATCTG (barcode) CCTACGGGNGGCWGCAG) and 805R (GACTGGAGTTCCTTGGVACCCGAGAATTCCAGACTACHVGGGTATCTAATCC) [22,23], followed by a second round of ampli cation with the same primer pairs. After ampli cation, gel electrophoresis was performed to detect the ampli ed products.…”

Section: Microbial Analysismentioning

confidence: 99%

Electricity generation and pollutants removal of landfill leachate by osmotic microbial fuel cells with different forward osmosis membranes

Jiang

Huang

Cai

et al. 2020

Preprint

View full text Add to dashboard Cite

In this study, thin-film composite with embedded polyester screen (TFC-ES), cellulose triacetate with a cast nonwoven (CTA-NW) and cellulose triacetate with embedded polyester screen (CTA-ES) were examined as the intermediate membranes in osmotic microbial fuel cells (OsMFCs). The reactors were fed with actual landfill leachate and the performance was studied in two operation modes: active layer facing draw solution (AL-DS) and active layer facing feed solution (AL-FS). The OsMFC with CTA-ES exhibited the best energy generation (maximum power density: 0.44 W m-2) and pollutant removal efficiency (ammonia nitrogen: 70.12 ± 0.28%, total nitrogen: 74.04 ± 0.33%) in the AL-FS mode, which could be ascribed to the lowest internal resistance (236.75 ohm) and highest microbial richness. Pseudomonas was the highest proportion of microbial in OsMFCs. The results of this study has demonstrated the potential of OsMFCs for landfill leachate treatment.

show abstract

Synchronously electricity generation and degradation of biogas slurry using microbial fuel cell

Cited by 30 publications

References 38 publications

A Review of Key Technologies and Trends in the Development of Integrated Heating and Power Systems in Agriculture

A Review of Key Technologies and Trends in the Development of Integrated Heating and Power Systems in Agriculture

Electricity generation and pollutants removal of landfill leachate by osmotic microbial fuel cells with different forward osmosis membranes

Electricity generation and pollutants removal of landfill leachate by osmotic microbial fuel cells with different forward osmosis membranes

Contact Info

Product

Resources

About