Synaptic localisation of SRF coactivators, MKL1 and MKL2, and their role in dendritic spine morphology

Abstract

The megakaryoblastic leukaemia (MKL) family are serum response factor (SRF) coactivators, which are highly expressed in the brain. Accordingly, MKL plays important roles in dendritic morphology, neuronal migration, and brain development. Further, nucleotide substitutions in the MKL1 and MKL2 genes are found in patients with schizophrenia and autism spectrum disorder, respectively. Thus, studies on the precise synaptic localisation and function of MKL in neurons are warranted. In this study, we generated and tested new antibodies that specifically recognise endogenously expressed MKL1 and MKL2 proteins in neurons. Using these reagents, we biochemically and immunocytochemically show that MKL1 and MKL2 are localised at synapses. Furthermore, shRNA experiments revealed that postsynaptic deletion of MKL1 or MKL2 reduced the percentage of mushroom- or stubby-type spines in cultured neurons. Taken together, our findings suggest that MKL1 and MKL2 are present at synapses and involved in dendritic spine maturation. This study may, at least in part, contribute to better understanding of the molecular mechanisms underlying MKL-mediated synaptic plasticity and neurological disorders.

Involvement of SRF coactivator MKL2 in BDNF‐mediated activation of the synaptic activity‐responsive element in the Arc gene

“…Previously, we reported the generation and evaluation of antibodies against MKL1 and MKL2 (Kaneda et al . ). Our western blotting revealed that the anti‐MKL1 antibody does not recognize MKL2, and the anti‐MKL2 antibody does not recognize MKL1 (Kaneda et al .…”

“…Our western blotting revealed that the anti‐MKL1 antibody does not recognize MKL2, and the anti‐MKL2 antibody does not recognize MKL1 (Kaneda et al . ). In addition, according to full blot images, other major extra bands were not detected (Supplementary information, Kaneda et al .…”

“…The control vector, for knockdown experiments, shR‐Luc, which targets Renilla luciferase gene, was constructed by mutagenesis of pSUPER using the KOD‐Plus mutagenesis kit with primers (Table , Primers for control vector construction of knock‐down experiment) (Kaneda et al . ). The vector for enhanced green fluorescent protein (pEGFP‐C1) was purchased from Clontech (6084‐1, Polo Alto, CA, USA).…”

“…Guinea pig anti‐MKL1 [1.14 μg/mL for immunostaining; 10 μg for chromatin immunoprecipitation (ChIP) assays; 0.114 μg/mL for western blotting] and anti‐MKL2 (2.5 μg/mL for immunostaining; 10 μg for ChIP assays; 0.25 μg/mL for western blotting) antibodies were generated in‐house and evaluated (Kaneda et al . ).…”

“…The vector was constructed by ligation of double-stranded DNAs (MKL1 (5 0 -GATCCCCGGTAGCAGACAGTTCCTCCTTCAAGAGAGGAG-GAACTGTCTGCTACCTTTTTA-3 0 and 5 0 -AGCTTAAAAAGGT AGCAGACAGTTCCTCCTCTCTTGAAGGAGGAACTGTCTGCT ACCGGG-3 0 ; MKL2 (5 0 -GATCCCCGCCATCCCAAGAATCCA-AATTCAAGAGATTTGGATTCTTGGGATGGCTTTTTA-3 0 and 5 0 -AGCTTAAAAAGCCATCCCAAGAATCCAAAT CTCTTGAA-TTTGGATTCTTGGGATGGCGGG-3 0 ) into HindIII/BglII sites of the pSUPER vector. The control vector, for knockdown experiments, shR-Luc, which targets Renilla luciferase gene, was constructed by mutagenesis of pSUPER using the KOD-Plus mutagenesis kit with primers ( Table 1, Primers for control vector construction of knockdown experiment) (Kaneda et al 2018). The vector for enhanced green fluorescent protein (pEGFP-C1) was purchased from Clontech (6084-1, Polo Alto, CA, USA).…”