Symbiont community diversity is more variable in corals that respond poorly to stress

Abstract

Coral reefs are declining globally as climate change and local water quality press environmental conditions beyond the physiological tolerances of holobionts—the collective of the host and its microbial symbionts. To assess the relationship between symbiont composition and holobiont stress tolerance, community diversity metrics were quantified for dinoflagellate endosymbionts (Family: Symbiodiniaceae) from eight Acropora millepora genets that thrived under or responded poorly to various stressors. These eight selected genets represent the upper and lower tails of the response distribution of 40 coral genets that were exposed to four stress treatments (and control conditions) in a 10‐day experiment. Specifically, four ‘best performer’ coral genets were analyzed at the end of the experiment because they survived high temperature, high pCO2, bacterial exposure, or combined stressors, whereas four ‘worst performer’ genets were characterized because they experienced substantial mortality under these stressors. At the end of the experiment, seven of eight coral genets mainly hosted Cladocopium symbionts, whereas the eighth genet was dominated by both Cladocopium and Durusdinium symbionts. Symbiodiniaceae alpha and beta diversity were higher in worst performing genets than in best performing genets. Symbiont communities in worst performers also differed more after stress exposure relative to their controls (based on normalized proportional differences in beta diversity), than did best performers. A generalized joint attribute model estimated the influence of host genet and treatment on Symbiodiniaceae community composition and identified strong associations among particular symbionts and host genet performance, as well as weaker associations with treatment. Although dominant symbiont physiology and function contribute to host performance, these findings emphasize the importance of symbiont community diversity and stochasticity as components of host performance. Our findings also suggest that symbiont community diversity metrics may function as indicators of resilience and have potential applications in diverse disciplines from climate change adaptation to agriculture and medicine.

Increased diversity and concordant shifts in community structure of coral‐associated Symbiodiniaceae and bacteria subjected to chronic human disturbance

“…The community structure component of beta diversity varied across the human disturbance gradient for both Symbiodiniaceae and bacteria, while the variation component only varied across the human disturbance gradient for Symbiodiniaceae. This supports evidence showing that beta diversity of coral microorganisms is affected by local human disturbance (Zaneveld et al., 2017), and is congruent with evidence that symbiont community diversity is more variable in stress‐sensitive corals (Howe‐Kerr et al., 2020).…”

Fish predation on corals promotes the dispersal of coral symbionts

“…DNA was extracted using the ZymoBIOMICs DNA/RNA Miniprep kit (Zymo Research, CA), and the internal transcribed spacer-2 (ITS-2) region of Symbiodiniaceae rDNA was sequenced following Howe-Kerr et al [ 27 ] using the primers SYM_VAR_5.8SII (5′ GAATTGCAGAACTCCGTGAACC 3′) and SYM_VAR_REV (5′ CGGGTTCWCTTGTYTGACTTCATGC 3′) [ 30 ] and sequenced on the Illumina MiSeq platform at the Georgia Genomics and Bioinformatics Core (University of Georgia, Athens, GA) following details outlined in Howe-Kerr et al [ 27 ]. The resulting sequencing data were processed using Symportal [ 29 ].…”

Fish predation on corals promotes the dispersal of coral symbionts

“…Genomic material was extracted using the ZymoBIOMICs DNA/RNA Miniprep kit (Zymo Research, CA), and the internal transcribed spacer-2 (ITS-2) region of Symbiodiniaceae rDNA was sequenced following Howe-Kerr et al (2020) using the primers SYM_VAR_5.8SII and SYM_VAR_REV (Hume et al, 2018). The resulting sequencing data were processed using Symportal (Hume et al, 2019).…”

“…DNA was extracted using the ZymoBIOMICs DNA/RNA Miniprep kit shield (Zymo Research, CA). The ITS-2 region of Symbiodiniaceae rDNA was amplified using SYM_VAR_5.8SII (5’ GAATTGCAGAACTCCGTGAACC 3’) and SYM_VAR_REV (5’ CGGGTTCWCTTGTYTGACTTCATGC 3’) primers (Hume et al, 2018) and sequenced on the Illumina MiSeq platform at the Georgia Genomics and Bioinformatics Core (University of Georgia, Athens, GA) following details outlined in Howe-Kerr et al (2020). Demultiplexed fastq files were generated with Illumina’s BaseSpaceFS (version 1.5.964) and fastq files were processed using Symportal (Hume et al, 2019).…”