Switching between humoral and cellular immune responses in Drosophila is guided by the cytokine GBP

Abstract

Insects combat infection through carefully measured cellular (for example, phagocytosis) and humoral (for example, secretion of antimicrobial peptides (AMPs)) innate immune responses. Little is known concerning how these different defense mechanisms are coordinated. Here, we use insect plasmatocytes and hemocyte-like Drosophila S2 cells to characterize mechanisms of immunity that operate in the haemocoel. We demonstrate that a Drosophila cytokine, growth-blocking peptides (GBP), acts through the phospholipase C (PLC)/Ca2+ signalling cascade to mediate the secretion of Pvf, a ligand for platelet-derived growth factor- and vascular endothelial growth factor-receptor (Pvr) homologue. Activated Pvr recruits extracellular signal-regulated protein kinase to inhibit humoral immune responses, while stimulating cell ‘spreading’, an initiating event in cellular immunity. The double-stranded RNA (dsRNA)-targeted knockdown of either Pvf2 or Pvr inhibits GBP-mediated cell spreading and activates AMP expression. Conversely, Pvf2 overexpression enhances cell spreading but inhibits AMP expression. Thus, we describe mechanisms to initiate immune programs that are either humoral or cellular in nature, but not both; such immunophysiological polarization may minimize homeostatic imbalance during infection.

Antimicrobial defence and persistent infection in insects revisited

“…Recent work in Drosophila on growth-blocking peptides (GBP) supports this notion [17]. GBP mediates cellular immune responses and simultaneously suppresses AMP expression via Pvf2 or Pvr.…”

Heat stress hardening of oriental armyworms is induced by a transient elevation of reactive oxygen species during sublethal stress

“…First‐strand cDNA was synthesized with oligo(dT) 12‐18 primer using ReverTra Ace RT‐PCR kit (Toyobo). qPCR analysis of each gene was carried out using a Light‐Cycler 1.3 instrument (Roche Applied Science) under the following conditions: 45 cycles at 95°C for 10 s, 55°C for 10 s, and 72°C for 20 s (Tsuzuki et al., , ). PCR specificity was confirmed by sequencing the PCR products and melting curve analysis at each data point.…”

“…All samples were analyzed in duplicate, and assay variation was typically within 10%. Data were normalized to the expression level of rp49 determined in duplicate by reference to a serial dilution calibration curve (Bustin et al., ; Tsuzuki et al., ). Primer pairs of target genes indicated in Section are: rp49 , TGACAAACTCAAGCGTAACTGGC and TTGCGGAAACCATTGGGCAG; Hsp70 , TCGGCCAAAGAGAACAGCAC and CGCTGCCTCTGCTTCTCATC; catalase (cat) , AAAGGAGCTGGAGCTTT and CTTCTGAGTATGGATAAA; superoxide dismutase 1 (SOD1) , TGGCTGCATGTCGTC and AGATCATCGGCATCGG; SOD2 , CCACATCAACCACACC and CGTTCTTGTACTGCAG.…”

A gene‐driven recovery mechanism: Drosophila larvae increase feeding activity for post‐stress weight recovery

“…D. melanogaster y w strain stocks were reared on standard cornmeal‐glucose‐yeast medium at 23°C (Tsuzuki et al., ). In most of experiments, 2nd instar larvae aged 70–80 h after egg laying were used.…”