Survival and reproduction of plant species in the Qinghai–Tibet Plateau

Abstract

The Qinghai-Tibet Plateau (QTP) is the highest and largest plateau in the world. It covers correspondingly wide geological, topographical, and climatic gradients, and thus hosts greater biodiversity than surrounding lowlands and other high elevation regions. Due to its extreme environmental and biological diversity, the QTP is an ideal region for studying adaptations of plant species under harsh environmental conditions at multiple evolutionary levels. Many recent ecological studies have revealed functions of distinctive morphological features of various plants in the region that improve their reproductive success. Examples include large and showy bracts, hairy inflorescences, and drooping flowers. Numerous other investigations have examined QTP plants' sexual systems, patterns of biomass allocations, and biotic interactions. This paper summarizes recent advances in understanding of morphological adaptations, plantplant interactions, plant-pollinator interactions, floral color patterns, pollination adaptations, and resource allocation patterns of alpine plants of the QTP. The overall aim is to synthesize current knowledge of the general mechanisms of plant survival and reproduction in this fascinating region.

Systematics, biogeography, and character evolution of Deutzia (Hydrangeaceae) inferred from nuclear and chloroplast DNA sequences

“…Thus, the monophyly and relatives of this genus could be 16 evaluated by better sampling of the taxon. 17 Until now, the few works proposing an infrageneric classification of Deutzia have 18 been based on morphological observations (Zaikonnikova, 1966;Hwang, 1993). Three 19 sections are recognized within the genus -Deutzia, Mesodeutzia, and Neodeutzia - 20 based on petal arrangements and the number of stamens (Zaikonnikova, 1966;Hwang, 21 1993): sect.…”

“…Furthermore, few strongly 15 supported (BP >90) incongruent clades were found upon comparison of parsimony 16 bootstrap consensus trees generated from the two data sets. Thus, we chose to combine 17 nrDNA and cpDNA data sets with their weakly-incongruent trees, as suggested by 18 Sheahan and Chase (2000) and Nie et al (2008). 19 Phylogenetic reconstructions of nrDNA, cpDNA, and combined datasets were 20 performed by maximum parsimony (MP) methods with PAUP * v.4.0b10 (Swofford,21 2002).…”

“…Neodeutzia. Based on results from previous phylogenetic 16 analyses of Hydrangeaceae (Soltis et al, 1995;Fan and Xiang, 2003;Xiang et al, 2011), 17 our outgroups were selected in order to sample taxa that are closely related to Deutzia as 18 well as some that are more distantly related within the Hydrangeaceae. Genomic DNA was extracted from silica-dried plant material and herbarium 7 specimens using a Universal Genomic DNA Extraction Kit (Takara, Dalian, China) 8 according to the manufacturer's specifications.…”

“…A new primer combination for the amplification of nrDNA 26S and 14 cpDNA matK and rbcL was designed based on the sequences of D. scabra available 15 from GeneBank (accession numbers JF321107 [26S], JF308685 [matK], and JF308656 16 [rbcL]). The small portion of the 26S region (892 bp long) was amplified and sequenced 17 using primers De26SF (5′-TCCGTCCAAGGCTAAATACG) and De26SR (5′- 18 GATTCGGCAGGTGAGTTGTT). The matK region was amplified using primers 19 DematKF (5′-TCCCATCCATCTGGAAATCT) and DematKR (5′-20 CCCCTGCGAAGTAGAAGAAG).…”

Plant Traits and Biomass Allocation of Gentiana Hexaphylla on Different Slope Aspects at the Eastern Margin of Qinghai-Tibet Plateau

“…Alpine plants can survive in extreme environments with different reproduction strategies to maintain the stabilization of populations (Stöcklin, 1992;Körner, 2003). Due to their extreme environmental conditions and high biodiversity, high mountain ecosystems are an ideal region for studying plant adaptations (Sun et al, 2014). Studying the growth traits, biomass allocation and reproduction of plants in severe environments is conductive to understanding the reasons for the biodiversity of high mountain ecosystems.…”