Surrogate hosts: Hunting dogs and recolonizing grey wolves share their endoparasites

Abstract

Understanding how closely related wildlife species and their domesticated counterparts exchange or share parasites, or replace each other in parasite life cycles, is of great interest to veterinary and human public health, and wildlife ecology. Grey wolves (Canis lupus) host and spread endoparasites that can either directly infect canid conspecifics or their prey serving as intermediate hosts of indirectly transmitted species. The wolf recolonization of Central Europe represents an opportunity to study parasite transmission dynamics between wildlife and domestic species for cases when a definitive host returns after local extinction – a situation equivalent to a ‘removal experiment’.Here we investigate whether the re–appearance of wolves has increased parasite pressure on hunting dogs – a group of companion animals of particular interest as they have a similar diet to wolves and flush wolf habitats when hunting. We compared prevalence (P) and species richness (SR) of helminths and the protozoan Sarcocystis to determine whether they were higher in hunting dogs from wolf areas (ndogs = 49) than a control area (ndogs = 29) without wolves. Of particular interest were S. grueneri and S. taeniata, known as ‘wolf specialists’.Five helminth and 11 Sarcocystis species were identified, of which all helminths and eight Sarcocystis species were shared between dogs and wolves. Overall prevalence and species richness of helminths (P:38.5% vs. 24.1%; SRmean:0.4 vs. 0.3 species) and Sarcocystis (P:63.3% vs. 65.5%, SRmean:2.1 vs. 1.8 species) did not differ between study sites. However, hunting dogs were significantly more likely to be infected with S. grueneri in wolf areas (P:45.2% vs. 10.5%; p = 0.035). The findings suggest that wolves indirectly increase S. grueneri infection risk for hunting dogs since cervids are intermediate hosts and occasionally fed to dogs. Furthermore, a periodic anthelminthic treatment of hunting dogs may be an effective measure to control helminth infections regardless of wolf presence.

Intestinal helminths in Iberian wolves (Canis lupus signatus) from Northwest Spain

“…Other authors reported the presence of Ancylostomidae gen. sp. (Ancylostoma/Uncinaria) between 2% and 45.7% [22,24]. Similar data have been published by other authors in Spain and Europe regarding the prevalence of Trichuris vulpis [25], except those from Balmori et al [26] in the Cantabrian Mountains (42.9%).…”

Correlates of parasites and pseudoparasites in wolves (Canis lupus) across continents: A comparison among Yellowstone (USA), Abruzzo (IT) and Mercantour (FR) national parks

“…faeces or vomitus). When parasites are shared by sympatric host species, entire communities might be affected (Holt and Dobson, 2007) and grey wolves ( Canis lupus ) living in sympatry with large, reservoir populations of dogs ( Canis familiaris ) are at a higher risk of infection (Murray et al, 1999; Randall et al, 2004; Cleaveland et al, 2007; Lesniak et al, 2017b). Close physical contact between group members is characteristic of social canids such as wolves and greatly enhances within-pack transmission of pathogens (Johnson et al, 1994).…”

“…A recent comparative survey of the presence of viruses in wolves indicated that density and spatial distribution of susceptible hosts, particularly free-ranging dogs, can be important factors influencing infections in wolves (Molnar et al, 2014). However, the assessment of such drivers through comparison of different geographical regions is complicated by lack of data or by the adoption of different approaches, such as necropsy vs coprology (e.g., Guberti et al, 1993; Schurer et al, 2016; Lesniak et al, 2017a, 2017b). Coprology is a non-invasive technique to assess the occurrence of several pathogens (Torres et al, 2001; Kreeger, 2003; Bryan et al, 2012).…”

Recolonizing gray wolves increase parasite infection risk in their prey

“…Each forward and reverse oligonucleotide contained the Fluidigm‐specific common sequence tag CS1 (5′–ACACTGACGACATGGTTCTACA–[TS–For]–3′) or CS2 (5′–TACGGTAGCAGAGACTTGGTCT–[TS–Rev]–3′) to enable subsequent barcoding of the generated PCR products (Fluidigm, San Francisco, CA, USA). PCRs and metabarcoding of Sarcocystis ‐positive sample pools (roe deer: n WT  = 21, n CA  = 10; red deer: n WT  = 10, n CA  = 4; wild boar: n WT  = 20, n CA  = 10) were conducted as previously described (Lesniak, Franz et al., 2017). …”

“…(2017). Briefly, OTUs were assigned to Sarcocystis species sequences from a custom database (Lesniak, Franz et al., 2017) using BLAST ® (blastn; Altschul et al., 1990) with an identity threshold of 98%. Only hits with a biunique best bit score for one species were collected in a table including the respective Sarcocystis species, OTU, amplicon, and sample name.…”